View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429_low_2 (Length: 413)

Name: NF4429_low_2
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429_low_2
NF4429_low_2
[»] chr3 (3 HSPs)
chr3 (3-398)||(47191938-47192333)
chr3 (199-238)||(26693264-26693303)
chr3 (7-79)||(26745712-26745784)


Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 3 - 398
Target Start/End: Original strand, 47191938 - 47192333
Alignment:
3 cagagaccaacctgttaacggcaaacactcaaaactctcacttttcaaaaacggtaatctcattttaaccgatgcagacagaaaaagaacaccaatttgg 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47191938 cagagaccaacctgttaacggcaaacactcaaaactctcacttttcaaaaacggtaatctcattttaaccgatgcagacagaaaaagaacaccaatttgg 47192037  T
103 tccacttcatccttttctccttttccattacagctcaagcttcaaaacaatggcaacctcgttctcgccacgaccaacggtaacattagtatcctttggc 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
47192038 tccacttcatccttttctccttttccattacagctcaagcttcaaaacaatggcaacctcgttctctccacgaccaacggtaacattagtatcctttggc 47192137  T
203 aaagctttgattttccaacagatactcttcttcctggccaagaaattaatgagcgagcaaccttagtttcatccaaaagtgaaacaaactattcctcagg 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47192138 aaagctttgattttccaacagatactcttcttcctggccaagaaattaatgagcgagcaaccttagtttcatccaaaagtgaaacaaactattcctcagg 47192237  T
303 tttctataagttttatttcgacaacgacaatgctcttcgtcttctattcaaaagtcctttgttatctagtgtctattggccatcaccttgggtatt 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47192238 tttctataagttttatttcgacaacgacaatgctcttcgtcttctattcaaaagtcctttgttatctagtgtctattggccatcaccttgggtatt 47192333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 199 - 238
Target Start/End: Original strand, 26693264 - 26693303
Alignment:
199 tggcaaagctttgattttccaacagatactcttcttcctg 238  Q
    ||||||||||||||||||||||||||||| || |||||||    
26693264 tggcaaagctttgattttccaacagataccctccttcctg 26693303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 26745784 - 26745712
Alignment:
7 gaccaacctgttaacggcaaacactcaaaactctcacttttcaaaaacggtaatctcattttaaccgatgcag 79  Q
    ||||||||||||||||| |||| ||||| ||| || ||| ||||||  || || |||||||||||||| ||||    
26745784 gaccaacctgttaacggaaaacgctcaacactttcccttctcaaaactggcaacctcattttaaccgacgcag 26745712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111565 times since January 2019
Visitors: 1375