View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-1 (Length: 593)

Name: NF4431-Insertion-1
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-1
NF4431-Insertion-1
[»] chr1 (1 HSPs)
chr1 (6-593)||(44864492-44865079)


Alignment Details
Target: chr1 (Bit Score: 556; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 556; E-Value: 0
Query Start/End: Original strand, 6 - 593
Target Start/End: Complemental strand, 44865079 - 44864492
Alignment:
6 catcactaattctccgcaacatgcttattatgtaatgatttatagcaagggaattgcttttataaaacttgagcaaccaacacaatttctgaatgatact 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44865079 catcactaattctccgcaacatgcttattatgtaatgatttatagcaagggaattgcttttataaaacttgagcaaccaacacaatttctgaatgatact 44864980  T
106 gtgattcgcaaaggcagagacaagcgtcgaaacattgaaatcaacttcactaactgcatttatttgctcatcttcagaaaaatcaccagtgtcatccaac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44864979 gtgattcgcaaaggcagagacaagcgtcgaaacattgaaatcaacttcactaactgcatttatttgctcatcttcagaaaaatcaccagtgtcatccaac 44864880  T
206 atatcctcattaggatgttcaggatttgtgttttccattggtttcataccaacttgggagttcacatcttcctcgacatcttcatttttattatcatcaa 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44864879 atatcctcattaggatgttcaggatttgtgttttccattggtttcataccaacttgggagttcacatcttcctcgacatcttcatttttattatcatcaa 44864780  T
306 gatttgtatttctcactgattccacaccaatttcagagttcacatctctcttgacattatcatctccattatcatcaagatttctgttttccgttggttc 405  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||     
44864779 gatttgtgtttctcactgattccacaccaatttcaaagttcacatctctcttgacattattatctccattatcatcaagatttctgttttccattggttt 44864680  T
406 caaacgaacttgggagttcacatctttctcgagattttgatgttcattatcacgaggggtgtcttcttgctcagtggaatttgcatttggtatggattcc 505  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
44864679 caaacgaacttgggagttcacatctttctcgagattttgatgttcattatcatgaggggtgtcttcttgctcggtggaatttgcatttggtatggattcc 44864580  T
506 ttctgcagcaactgattttcagctaattgattgtcaatagaaatgctggcttctttttgaatgcaagactgatctccagttggtttat 593  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
44864579 ttctgcagcaactgattttcagctaattgattgtcaatagaaatgctagcttctttttgaatgcaagactgatctccagttggtttat 44864492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295225 times since January 2019
Visitors: 3016