View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-1 (Length: 593)

Name: NF4431-Insertion-1
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431-Insertion-1
[»] chr1 (1 HSPs)
chr1 (6-593)||(44864492-44865079)

Alignment Details
Target: chr1 (Bit Score: 556; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 556; E-Value: 0
Query Start/End: Original strand, 6 - 593
Target Start/End: Complemental strand, 44865079 - 44864492
6 catcactaattctccgcaacatgcttattatgtaatgatttatagcaagggaattgcttttataaaacttgagcaaccaacacaatttctgaatgatact 105  Q
44865079 catcactaattctccgcaacatgcttattatgtaatgatttatagcaagggaattgcttttataaaacttgagcaaccaacacaatttctgaatgatact 44864980  T
106 gtgattcgcaaaggcagagacaagcgtcgaaacattgaaatcaacttcactaactgcatttatttgctcatcttcagaaaaatcaccagtgtcatccaac 205  Q
44864979 gtgattcgcaaaggcagagacaagcgtcgaaacattgaaatcaacttcactaactgcatttatttgctcatcttcagaaaaatcaccagtgtcatccaac 44864880  T
206 atatcctcattaggatgttcaggatttgtgttttccattggtttcataccaacttgggagttcacatcttcctcgacatcttcatttttattatcatcaa 305  Q
44864879 atatcctcattaggatgttcaggatttgtgttttccattggtttcataccaacttgggagttcacatcttcctcgacatcttcatttttattatcatcaa 44864780  T
306 gatttgtatttctcactgattccacaccaatttcagagttcacatctctcttgacattatcatctccattatcatcaagatttctgttttccgttggttc 405  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||     
44864779 gatttgtgtttctcactgattccacaccaatttcaaagttcacatctctcttgacattattatctccattatcatcaagatttctgttttccattggttt 44864680  T
406 caaacgaacttgggagttcacatctttctcgagattttgatgttcattatcacgaggggtgtcttcttgctcagtggaatttgcatttggtatggattcc 505  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
44864679 caaacgaacttgggagttcacatctttctcgagattttgatgttcattatcatgaggggtgtcttcttgctcggtggaatttgcatttggtatggattcc 44864580  T
506 ttctgcagcaactgattttcagctaattgattgtcaatagaaatgctggcttctttttgaatgcaagactgatctccagttggtttat 593  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
44864579 ttctgcagcaactgattttcagctaattgattgtcaatagaaatgctagcttctttttgaatgcaagactgatctccagttggtttat 44864492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 41366 times since January 2019
Visitors: 1501