View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-3 (Length: 579)

Name: NF4431-Insertion-3
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431-Insertion-3
[»] chr2 (1 HSPs)
chr2 (8-533)||(39246680-39247205)

Alignment Details
Target: chr2 (Bit Score: 514; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 514; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Original strand, 39246680 - 39247205
8 gttttagtcagcttcaagagtcgacattaaaatcctcaaataccactacacattcaagctcatcaagcatagtagctcccactttacagcacattgtcca 107  Q
39246680 gttttagtcagcttcaagagtcgacattaaaatcctcaaataccactacacattcaagctcatcaagcatagtagctcccactttacagcacattgtcca 39246779  T
108 actaattcaaatcaagtttatcacattcacatggcaaacacacaaataactatatttgcgctaataatcttcaccaccttcttgttcatgacattgcaag 207  Q
39246780 actaattcaaatcaagtttatcacattcacatggcaaacacacaaataactatatttgcgctaataatcttcaccaccttcttgttcatgacattgcaag 39246879  T
208 ctcgtactctccaacgccaccccttcactagagaaaaaagcaatgttgttagtcatcatgtgcttttttacaaattagtttctgatctatcgaagaatat 307  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
39246880 ctcgtactctccaaccccaccccttcactagagaaaaaagcaatgttgttagtcatcatgtgctttttcacaaattagtttctgatctatcgaagaatat 39246979  T
308 acataatattggtgatgttgctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaa 407  Q
39246980 acataatattggtgatgttgctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaa 39247079  T
408 aacaagtagctatatatataactctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccaccgttgatttgtt 507  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39247080 aacaagtagctatatatataactctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccactgttgatttgtt 39247179  T
508 ggtatgtcttaagaacagaactagta 533  Q
39247180 ggtatgtcttaagaacagaactagta 39247205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125213 times since January 2019
Visitors: 1454