View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-3 (Length: 579)

Name: NF4431-Insertion-3
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-3
NF4431-Insertion-3
[»] chr2 (1 HSPs)
chr2 (8-533)||(39246680-39247205)


Alignment Details
Target: chr2 (Bit Score: 514; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 514; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Original strand, 39246680 - 39247205
Alignment:
8 gttttagtcagcttcaagagtcgacattaaaatcctcaaataccactacacattcaagctcatcaagcatagtagctcccactttacagcacattgtcca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39246680 gttttagtcagcttcaagagtcgacattaaaatcctcaaataccactacacattcaagctcatcaagcatagtagctcccactttacagcacattgtcca 39246779  T
108 actaattcaaatcaagtttatcacattcacatggcaaacacacaaataactatatttgcgctaataatcttcaccaccttcttgttcatgacattgcaag 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39246780 actaattcaaatcaagtttatcacattcacatggcaaacacacaaataactatatttgcgctaataatcttcaccaccttcttgttcatgacattgcaag 39246879  T
208 ctcgtactctccaacgccaccccttcactagagaaaaaagcaatgttgttagtcatcatgtgcttttttacaaattagtttctgatctatcgaagaatat 307  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
39246880 ctcgtactctccaaccccaccccttcactagagaaaaaagcaatgttgttagtcatcatgtgctttttcacaaattagtttctgatctatcgaagaatat 39246979  T
308 acataatattggtgatgttgctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39246980 acataatattggtgatgttgctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaa 39247079  T
408 aacaagtagctatatatataactctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccaccgttgatttgtt 507  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39247080 aacaagtagctatatatataactctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccactgttgatttgtt 39247179  T
508 ggtatgtcttaagaacagaactagta 533  Q
    ||||||||||||||||||||||||||    
39247180 ggtatgtcttaagaacagaactagta 39247205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295864 times since January 2019
Visitors: 3016