View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-5 (Length: 463)

Name: NF4431-Insertion-5
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-5
NF4431-Insertion-5
[»] chr1 (1 HSPs)
chr1 (9-463)||(38943847-38944301)
[»] chr3 (4 HSPs)
chr3 (10-312)||(44171767-44172067)
chr3 (10-312)||(44192063-44192363)
chr3 (386-423)||(44171688-44171725)
chr3 (386-423)||(44191984-44192021)


Alignment Details
Target: chr1 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 9 - 463
Target Start/End: Complemental strand, 38944301 - 38943847
Alignment:
9 gtagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttctgttgttgcaaaattctcagggcctaaacatcgtttgg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38944301 gtagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttctgttgttgcaaaattctcagggcctaaacatcgtttgg 38944202  T
109 ctacatcagctactgtgaaggatgggaaagtgtacctaaaccatatggttggtattggataccctaaaaagaagcatgctattgttgaggctgtgtttta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
38944201 ctacatcagctactgtgaaggatgggaaagtgtacctaaaccatatggttggtattggataccctaaaaagaagcatgcaattgttgaggctgtgtttta 38944102  T
209 attcatagcaatttccataaatctaaacagatttggttgaaatttggtgttccttcggttttttatgtttggtttcgtagcatttattgatactatctag 308  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
38944101 attcatagcactttccataaatctaaacagatttggttgaaatttggtgttcctttggttttttatgtttggtttcgtagcatttattgatactatctag 38944002  T
309 aaaagataaactctggtggaaatttggtgtaactgtaagttcataaatgctgtagtccttgtttttgtctctgtcggtataatgctcaatgtcaatggta 408  Q
    |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38944001 aaagaataaactctggtggaaatttggtgtaactgtaagttcataaatgctgtagtccttgtttttgtctctgtcggtataatgctcaatgtcaatggta 38943902  T
409 ggataacatgttttctttcatcgtgaaataatctactacctcccactcccttcga 463  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38943901 ggataacatgttttctttcatcgtgaaataatctactacctcccactcccttcga 38943847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 312
Target Start/End: Complemental strand, 44172067 - 44171767
Alignment:
10 tagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttctgttgttgcaaaattctcagggcctaaacatcgtttggc 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |    
44172067 tagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttttgttgttgcaaaattctcagggcctaaacatcgtttgtc 44171968  T
110 tacatcagctactgtgaaggatgggaaagtgtacctaaaccatatggttggtattggataccctaaaaagaagcatgctattgttgaggctgtgttttaa 209  Q
    ||||||| | |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |  ||||||||    
44171967 tacatcaccaactgtgaaggatgggaaagtgtacctaaaccacatggttggaattggataccctaaaaagaagcatgctattgttgagac--tgttttaa 44171870  T
210 ttcatagcaatttccataaatctaaacagatttggttgaaatttggtgttccttcggttttttatgtttggtttcgtagcatttattgatactatctaga 309  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||| ||||||    
44171869 ttcatagcactttccataaatataaacagatttggttgaaatttggtgttccattggttttttatgtttggttttgtagcatttattgatactttctaga 44171770  T
310 aaa 312  Q
    |||    
44171769 aaa 44171767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 312
Target Start/End: Complemental strand, 44192363 - 44192063
Alignment:
10 tagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttctgttgttgcaaaattctcagggcctaaacatcgtttggc 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |    
44192363 tagttgctggaaatccttcagggagattagtggagagtttagatggatggaatacagcttttgttgttgcaaaattctcagggcctaaacatcgtttgtc 44192264  T
110 tacatcagctactgtgaaggatgggaaagtgtacctaaaccatatggttggtattggataccctaaaaagaagcatgctattgttgaggctgtgttttaa 209  Q
    ||||||| | |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |  ||||||||    
44192263 tacatcaccaactgtgaaggatgggaaagtgtacctaaaccacatggttggaattggataccctaaaaagaagcatgctattgttgagac--tgttttaa 44192166  T
210 ttcatagcaatttccataaatctaaacagatttggttgaaatttggtgttccttcggttttttatgtttggtttcgtagcatttattgatactatctaga 309  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||| ||||||    
44192165 ttcatagcactttccataaatataaacagatttggttgaaatttggtgttccattggttttttatgtttggttttgtagcatttattgatactttctaga 44192066  T
310 aaa 312  Q
    |||    
44192065 aaa 44192063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 386 - 423
Target Start/End: Complemental strand, 44171725 - 44171688
Alignment:
386 tataatgctcaatgtcaatggtaggataacatgttttc 423  Q
    ||||||||| ||||||||||||||||||||||||||||    
44171725 tataatgcttaatgtcaatggtaggataacatgttttc 44171688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 386 - 423
Target Start/End: Complemental strand, 44192021 - 44191984
Alignment:
386 tataatgctcaatgtcaatggtaggataacatgttttc 423  Q
    ||||||||| ||||||||||||||||||||||||||||    
44192021 tataatgcttaatgtcaatggtaggataacatgttttc 44191984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217061 times since January 2019
Visitors: 2908