View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-7 (Length: 289)

Name: NF4431-Insertion-7
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-7
NF4431-Insertion-7
[»] chr7 (1 HSPs)
chr7 (12-289)||(44241094-44241371)


Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 289
Target Start/End: Complemental strand, 44241371 - 44241094
Alignment:
12 ttcctaacagaagtaaaattaatttgaagtgcagcaatttctgcgtgatcatcacagcaagaaaggcaacccaaatcatgagagttgattttaataattc 111  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44241371 ttcctaacagaagtaaaattaatttgaagtgcagcagtttctgcgtgatcatcacagcaagaaaggcaacccaaatcatgagagttgattttaataattc 44241272  T
112 ttaaaattcaattctgttaatcaagtcttatccttgtgtaatgatgctcatagtttttgttgacatttagcaagctaataaatgacaattctacatgaag 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44241271 ttaaaattcaattctgttaatcaagtcttatccttgtgtaatgatgctcatagtttttgttgacatttagcaagctaataaatgacaattctacatgaag 44241172  T
212 gggaataaaagcaaaataagtctgctctgaaattgcacttactctccctgatcttcgaactcgcccatctaggcgcag 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44241171 gggaataaaagcaaaataagtctgctctgaaattgcacttactctccctgatcttcgaactcgcccatctaggcgcag 44241094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 115724 times since January 2019
Visitors: 1394