View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-7 (Length: 289)

Name: NF4431-Insertion-7
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431-Insertion-7
[»] chr7 (1 HSPs)
chr7 (12-289)||(44241094-44241371)

Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 289
Target Start/End: Complemental strand, 44241371 - 44241094
12 ttcctaacagaagtaaaattaatttgaagtgcagcaatttctgcgtgatcatcacagcaagaaaggcaacccaaatcatgagagttgattttaataattc 111  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44241371 ttcctaacagaagtaaaattaatttgaagtgcagcagtttctgcgtgatcatcacagcaagaaaggcaacccaaatcatgagagttgattttaataattc 44241272  T
112 ttaaaattcaattctgttaatcaagtcttatccttgtgtaatgatgctcatagtttttgttgacatttagcaagctaataaatgacaattctacatgaag 211  Q
44241271 ttaaaattcaattctgttaatcaagtcttatccttgtgtaatgatgctcatagtttttgttgacatttagcaagctaataaatgacaattctacatgaag 44241172  T
212 gggaataaaagcaaaataagtctgctctgaaattgcacttactctccctgatcttcgaactcgcccatctaggcgcag 289  Q
44241171 gggaataaaagcaaaataagtctgctctgaaattgcacttactctccctgatcttcgaactcgcccatctaggcgcag 44241094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191858 times since January 2019
Visitors: 2831