View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-9 (Length: 114)

Name: NF4431-Insertion-9
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431-Insertion-9
[»] scaffold0176 (1 HSPs)
scaffold0176 (8-114)||(31570-31676)
[»] chr7 (3 HSPs)
chr7 (8-114)||(34164749-34164855)
chr7 (8-114)||(34171246-34171352)
chr7 (8-114)||(34214844-34214950)
[»] chr2 (1 HSPs)
chr2 (51-106)||(38725417-38725472)

Alignment Details
Target: scaffold0176 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: scaffold0176

Target: scaffold0176; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 31676 - 31570
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
31676 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 31577  T
108 tccttcc 114  Q
31576 tccttcc 31570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 107; Significance: 4e-54; HSPs: 3)
Name: chr7

Target: chr7; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34164855 - 34164749
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
34164855 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34164756  T
108 tccttcc 114  Q
34164755 tccttcc 34164749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34171352 - 34171246
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
34171352 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34171253  T
108 tccttcc 114  Q
34171252 tccttcc 34171246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34214950 - 34214844
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
34214950 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34214851  T
108 tccttcc 114  Q
34214850 tccttcc 34214844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 106
Target Start/End: Original strand, 38725417 - 38725472
51 ccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatc 106  Q
    ||||| || |||||||||||||| |||||||||||||| ||||||  |||||||||    
38725417 ccaataaggaatgcagcttcagccacagctgcataaagacttccatgaccagcatc 38725472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 115680 times since January 2019
Visitors: 1394