View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-9 (Length: 114)

Name: NF4431-Insertion-9
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-9
NF4431-Insertion-9
[»] scaffold0176 (1 HSPs)
scaffold0176 (8-114)||(31570-31676)
[»] chr7 (3 HSPs)
chr7 (8-114)||(34164749-34164855)
chr7 (8-114)||(34171246-34171352)
chr7 (8-114)||(34214844-34214950)
[»] chr2 (1 HSPs)
chr2 (51-106)||(38725417-38725472)


Alignment Details
Target: scaffold0176 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 31676 - 31570
Alignment:
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31676 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 31577  T
108 tccttcc 114  Q
    |||||||    
31576 tccttcc 31570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 107; Significance: 4e-54; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34164855 - 34164749
Alignment:
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34164855 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34164756  T
108 tccttcc 114  Q
    |||||||    
34164755 tccttcc 34164749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34171352 - 34171246
Alignment:
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34171352 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34171253  T
108 tccttcc 114  Q
    |||||||    
34171252 tccttcc 34171246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 34214950 - 34214844
Alignment:
8 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34214950 atataactatagttatatataatcaaacctattcttttcaagcccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatct 34214851  T
108 tccttcc 114  Q
    |||||||    
34214850 tccttcc 34214844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 106
Target Start/End: Original strand, 38725417 - 38725472
Alignment:
51 ccaatgagaaatgcagcttcagcaacagctgcataaaggcttccagcaccagcatc 106  Q
    ||||| || |||||||||||||| |||||||||||||| ||||||  |||||||||    
38725417 ccaataaggaatgcagcttcagccacagctgcataaagacttccatgaccagcatc 38725472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191801 times since January 2019
Visitors: 2831