View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431_high_3 (Length: 320)

Name: NF4431_high_3
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431_high_3
[»] chr8 (1 HSPs)
chr8 (1-309)||(41125936-41126244)

Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 41125936 - 41126244
1 atctcctcatcctttttgttttgatatcaccgccaacactttccaacatattccagaaaccagaatggagatatggttcatcgtcttagtttctgtatgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||    
41125936 atctcctcatcctttttgttttgatatcaccgccaacactttccaacatattccagaaaccagaatggagacatggttcatcgtcttattttctgtatgt 41126035  T
101 gtgtgttggttgatcaaagccaccctctccatcactgctaagagtgtaagcctccctcctggccctccacacatacctatcatcacacccctcttatggc 200  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126036 gtgtgttggttgatcaaagccaccctctccatcactactaagagtgtaagcctccctcctggccctccacacatacctatcatcacacccctcttatggc 41126135  T
201 ttagaaaatcattcgcccaaacccaacttgtaccctttcttcgaaccctacatgcaaaacatggtccaataattagtcttcaaatcattttccgtcgaat 300  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126136 ttagaaaatcattcacccaaacccaacttgtaccctttcttcgaaccctacatgcaaaacatggtccaataattagtcttcaaatcattttccgtcgaat 41126235  T
301 cgtattcat 309  Q
41126236 cgtattcat 41126244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176090 times since January 2019
Visitors: 2680