View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431_high_3 (Length: 320)

Name: NF4431_high_3
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431_high_3
NF4431_high_3
[»] chr8 (1 HSPs)
chr8 (1-309)||(41125936-41126244)


Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 41125936 - 41126244
Alignment:
1 atctcctcatcctttttgttttgatatcaccgccaacactttccaacatattccagaaaccagaatggagatatggttcatcgtcttagtttctgtatgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||    
41125936 atctcctcatcctttttgttttgatatcaccgccaacactttccaacatattccagaaaccagaatggagacatggttcatcgtcttattttctgtatgt 41126035  T
101 gtgtgttggttgatcaaagccaccctctccatcactgctaagagtgtaagcctccctcctggccctccacacatacctatcatcacacccctcttatggc 200  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126036 gtgtgttggttgatcaaagccaccctctccatcactactaagagtgtaagcctccctcctggccctccacacatacctatcatcacacccctcttatggc 41126135  T
201 ttagaaaatcattcgcccaaacccaacttgtaccctttcttcgaaccctacatgcaaaacatggtccaataattagtcttcaaatcattttccgtcgaat 300  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126136 ttagaaaatcattcacccaaacccaacttgtaccctttcttcgaaccctacatgcaaaacatggtccaataattagtcttcaaatcattttccgtcgaat 41126235  T
301 cgtattcat 309  Q
    |||||||||    
41126236 cgtattcat 41126244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38051 times since January 2019
Visitors: 1598