View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431_high_6 (Length: 304)

Name: NF4431_high_6
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431_high_6
NF4431_high_6
[»] chr5 (6 HSPs)
chr5 (10-304)||(1945507-1945815)
chr5 (257-303)||(16666193-16666239)
chr5 (260-298)||(32903416-32903454)
chr5 (251-304)||(28247421-28247474)
chr5 (255-299)||(15921678-15921722)
chr5 (257-299)||(42885643-42885685)
[»] chr7 (6 HSPs)
chr7 (254-298)||(38032592-38032636)
chr7 (257-304)||(21859632-21859679)
chr7 (257-299)||(21237142-21237184)
chr7 (257-304)||(784022-784069)
chr7 (257-304)||(2243203-2243250)
chr7 (257-299)||(35444715-35444757)
[»] chr3 (6 HSPs)
chr3 (256-304)||(44790915-44790963)
chr3 (257-304)||(6418727-6418774)
chr3 (257-304)||(42875918-42875965)
chr3 (256-304)||(3858528-3858576)
chr3 (255-299)||(29839196-29839240)
chr3 (257-299)||(24735414-24735456)
[»] chr6 (2 HSPs)
chr6 (256-299)||(32923522-32923565)
chr6 (257-298)||(28590546-28590587)
[»] chr4 (8 HSPs)
chr4 (256-299)||(5487063-5487106)
chr4 (257-304)||(46251380-46251427)
chr4 (257-299)||(44820310-44820352)
chr4 (257-298)||(42595845-42595886)
chr4 (260-300)||(18906156-18906196)
chr4 (257-299)||(29285291-29285333)
chr4 (255-304)||(46395298-46395347)
chr4 (259-304)||(51970736-51970781)
[»] chr1 (2 HSPs)
chr1 (257-304)||(16544166-16544213)
chr1 (257-303)||(12417505-12417551)
[»] chr2 (1 HSPs)
chr2 (259-304)||(17842014-17842059)
[»] chr8 (3 HSPs)
chr8 (257-299)||(41288233-41288275)
chr8 (257-298)||(33358967-33359008)
chr8 (255-287)||(16028268-16028300)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 304
Target Start/End: Complemental strand, 1945815 - 1945507
Alignment:
10 gcaaaggctatgggaagtttgtataagaagaaaacattagccgattaatagaatagaata--------aataatactcttcaatgttatgtgatttcatg 101  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||        ||||||||||||||||||||||||||||||||    
1945815 gcaaaggctatgggaagcttgtataagaagaaaacattagccgattaataaaatagaatagaataaataataatactcttcaatgttatgtgatttcatg 1945716  T
102 ttaattactactttcacttgttatatgaacagttgtaaaaaa-tgtgtacttgagcatgtgaatttgctttgcacgaagaaaacattaaatg-----tac 195  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||     |||    
1945715 ttaattactactttcacttgttatatgaacagttgtaaaaaaatgtgtacttgagcatgtgaatttgctttgcatgaagaaaacatcaaatgaactatac 1945616  T
196 tttgatcttcttttcttttttgacaaacaaaaattaatatgtataaatatacccacacgagtagggatgtcaatgggtacccatggatacagatagtatg 295  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||    
1945615 tttgatcttcttttcttttttgacaaacaaaaattaatatgtatgaatatacccacacgagtagggatgtcaatgagtacccatgggtacagatagtatg 1945516  T
296 atactcgtc 304  Q
    |||||||||    
1945515 atactcgtc 1945507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 16666193 - 16666239
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgt 303  Q
    ||||||||||||||| |||||||||| || |||||||||||||||||    
16666193 tagggatgtcaatggatacccatggacacggatagtatgatactcgt 16666239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 298
Target Start/End: Original strand, 32903416 - 32903454
Alignment:
260 ggatgtcaatgggtacccatggatacagatagtatgata 298  Q
    |||||||||||||||||||||||||| ||||||||||||    
32903416 ggatgtcaatgggtacccatggatacggatagtatgata 32903454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 251 - 304
Target Start/End: Complemental strand, 28247474 - 28247421
Alignment:
251 cacgagtagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||| ||||||||||||||||||| ||||| ||| |||| |||||||||||||    
28247474 cacgaatagggatgtcaatgggtactcatgggtacggataatatgatactcgtc 28247421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 299
Target Start/End: Complemental strand, 15921722 - 15921678
Alignment:
255 agtagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||||||||||||||| ||| |||| ||||||||    
15921722 agtagggatgtcaatgggtacccatgggtacggataatatgatac 15921678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 299
Target Start/End: Complemental strand, 42885685 - 42885643
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||| |||||||||| || |||||||||||||    
42885685 tagggatgtcaatggatacccatggacacggatagtatgatac 42885643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 298
Target Start/End: Complemental strand, 38032636 - 38032592
Alignment:
254 gagtagggatgtcaatgggtacccatggatacagatagtatgata 298  Q
    |||||||||||||||||||||||||||| ||||||||||||||||    
38032636 gagtagggatgtcaatgggtacccatgggtacagatagtatgata 38032592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Complemental strand, 21859679 - 21859632
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||||| ||||||||| |||| |||||||||||||||||    
21859679 tagggatgtcaatggatacccatgggtacaaatagtatgatactcgtc 21859632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 299
Target Start/End: Complemental strand, 21237184 - 21237142
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||||||||||||| ||| |||||||||||||    
21237184 tagggatgtcaatgggtacccatgggtacggatagtatgatac 21237142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 304
Target Start/End: Complemental strand, 784069 - 784022
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||||||||| ||||| ||| ||||||||||||| ||||    
784069 tagggatgtcaatgggtactcatgggtacggatagtatgatacacgtc 784022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 304
Target Start/End: Complemental strand, 2243250 - 2243203
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||||| || |||||| ||| ||||||||||||||||||    
2243250 tagggatgtcaatggatatccatgggtacggatagtatgatactcgtc 2243203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 299
Target Start/End: Original strand, 35444715 - 35444757
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||| |||||||||| || |||||||||||||    
35444715 tagggatgtcaatggatacccatggacacggatagtatgatac 35444757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 256 - 304
Target Start/End: Original strand, 44790915 - 44790963
Alignment:
256 gtagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    |||||||||||||||||||||||||| ||| ||||||||||||| ||||    
44790915 gtagggatgtcaatgggtacccatgggtacggatagtatgatacccgtc 44790963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 6418727 - 6418774
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    |||||||||||||||||| |||||| |||||||||||||||| |||||    
6418727 tagggatgtcaatgggtatccatgggtacagatagtatgatattcgtc 6418774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Complemental strand, 42875965 - 42875918
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    |||||||||||||||||||| |||| ||||||||||||||||| ||||    
42875965 tagggatgtcaatgggtacctatgggtacagatagtatgatacccgtc 42875918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 304
Target Start/End: Complemental strand, 3858576 - 3858528
Alignment:
256 gtagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    |||||||||||||||||||||||||| |||  |||||||||||| ||||    
3858576 gtagggatgtcaatgggtacccatgggtacgaatagtatgatacacgtc 3858528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 299
Target Start/End: Original strand, 29839196 - 29839240
Alignment:
255 agtagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||||| |||||||||| || |||||||||||||    
29839196 agtagggatgtcaatggatacccatggacacggatagtatgatac 29839240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 299
Target Start/End: Original strand, 24735414 - 24735456
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||| |||||||||| || |||||||||||||    
24735414 tagggatgtcaatggatacccatggacacggatagtatgatac 24735456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 299
Target Start/End: Complemental strand, 32923565 - 32923522
Alignment:
256 gtagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    |||||||||||||||||||||||||| |||||||||||| ||||    
32923565 gtagggatgtcaatgggtacccatgggtacagatagtataatac 32923522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 298
Target Start/End: Complemental strand, 28590587 - 28590546
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgata 298  Q
    ||||||||||||||||||||||||| ||| |||| |||||||    
28590587 tagggatgtcaatgggtacccatgggtacggataatatgata 28590546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 299
Target Start/End: Complemental strand, 5487106 - 5487063
Alignment:
256 gtagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||||||||||||||| || |||||||||||||    
5487106 gtagggatgtcaatgggtacccatggacacggatagtatgatac 5487063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 46251380 - 46251427
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||||||||||||||||||  |||||||||||| |||||    
46251380 tagggatgtcaatgggtacccatggatattgatagtatgatattcgtc 46251427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 299
Target Start/End: Original strand, 44820310 - 44820352
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    |||||||||||||||||||||||||| || |||||||||||||    
44820310 tagggatgtcaatgggtacccatggacacggatagtatgatac 44820352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 298
Target Start/End: Complemental strand, 42595886 - 42595845
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgata 298  Q
    |||||||||||||||||| |||||||||| ||||||||||||    
42595886 tagggatgtcaatgggtatccatggatacggatagtatgata 42595845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 300
Target Start/End: Original strand, 18906156 - 18906196
Alignment:
260 ggatgtcaatgggtacccatggatacagatagtatgatact 300  Q
    |||||| ||||||||||||||| ||||||||||||||||||    
18906156 ggatgttaatgggtacccatgggtacagatagtatgatact 18906196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 299
Target Start/End: Complemental strand, 29285333 - 29285291
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||| |||||||||| || |||||||||||||    
29285333 tagggatgtcaatggatacccatggacacggatagtatgatac 29285291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 304
Target Start/End: Complemental strand, 46395347 - 46395298
Alignment:
255 agtagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||| |||||||||||||||||||| |||| |||| |||||||| ||||    
46395347 agtagtgatgtcaatgggtacccatgaatacggataatatgatacccgtc 46395298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 304
Target Start/End: Complemental strand, 51970781 - 51970736
Alignment:
259 gggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    |||||||||||| ||| ||||||||||||||||||  |||||||||    
51970781 gggatgtcaatgagtatccatggatacagatagtacaatactcgtc 51970736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Complemental strand, 16544213 - 16544166
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||||||| ||||||| ||||||||||||||||| ||||    
16544213 tagggatgtcaatgggttcccatgggtacagatagtatgatacccgtc 16544166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 12417551 - 12417505
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatactcgt 303  Q
    ||||||||||||||| ||| ||||||||||||| |||||||||||||    
12417551 tagggatgtcaatggatactcatggatacagatcgtatgatactcgt 12417505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 304
Target Start/End: Complemental strand, 17842059 - 17842014
Alignment:
259 gggatgtcaatgggtacccatggatacagatagtatgatactcgtc 304  Q
    ||||||||||||| ||||||| ||||| ||||||||||||||||||    
17842059 gggatgtcaatggatacccatagatacggatagtatgatactcgtc 17842014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 299
Target Start/End: Complemental strand, 41288275 - 41288233
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgatac 299  Q
    ||||||||||||||| |||||||||| || |||||||||||||    
41288275 tagggatgtcaatggatacccatggacacggatagtatgatac 41288233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 298
Target Start/End: Original strand, 33358967 - 33359008
Alignment:
257 tagggatgtcaatgggtacccatggatacagatagtatgata 298  Q
    |||||||||||||| |||||||||| ||| ||||||||||||    
33358967 tagggatgtcaatgagtacccatgggtacggatagtatgata 33359008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 287
Target Start/End: Complemental strand, 16028300 - 16028268
Alignment:
255 agtagggatgtcaatgggtacccatggatacag 287  Q
    |||||||||||||||||||| ||||||||||||    
16028300 agtagggatgtcaatgggtatccatggatacag 16028268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 318578 times since January 2019
Visitors: 3039