View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431_high_7 (Length: 304)

Name: NF4431_high_7
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431_high_7
NF4431_high_7
[»] chr2 (1 HSPs)
chr2 (1-293)||(26373141-26373432)
[»] scaffold1445 (1 HSPs)
scaffold1445 (130-244)||(1687-1796)


Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 26373432 - 26373141
Alignment:
1 cagactgcaggcaaatacacctgcttttattcgtacgcctctctcaaatcttggtatcctcataatccttactttattagctaccaagaatacaaattgt 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26373432 cagaatgcaggcaaatacacctgcttttattcgtacgcctctctcaa-tctcggtatcctcataatccttactttattagctaccaagaatacaaattgt 26373334  T
101 tgagctgatgttcagttcaccatgtcataaaaatagcttttaatgatgaatatagttacattatgactaaccaaatcattttgtggaataacaatttcag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
26373333 tgagctgatgttcagttcaccatgtcataaaaatagcttttaatgatgaatataattacattatgactaaccaaatcattttgtggaataacaatttcag 26373234  T
201 ctaatgccaaaagggtgcacaagaaccattttcaacataccaagttaaactagtattcaccacaaacattatatgcattccgtctattttcat 293  Q
     ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26373233 ttaatgccaaaaggttgcacaagaaccattttcaacataccaagttaaactagtattcaccacaaacattatatgcattccgtctattttcat 26373141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1445 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1445
Description:

Target: scaffold1445; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 130 - 244
Target Start/End: Complemental strand, 1796 - 1687
Alignment:
130 aaaatagcttttaatgatgaatata-gttacattatgactaaccaaatcattttgtggaataacaatttcagctaatgccaaaagggtgcacaagaacca 228  Q
    ||||||||||||| ||||||||||| ||||||||     |||||||||||||  |  ||||||| |||||||||  |||||||||| | |||||||||      
1796 aaaatagctttta-tgatgaatataagttacatt-----taaccaaatcattaagcagaataacgatttcagctggtgccaaaaggctccacaagaacat 1703  T
229 ttttcaacataccaag 244  Q
    |||||||| |||||||    
1702 ttttcaacctaccaag 1687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175724 times since January 2019
Visitors: 2679