View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431_high_7 (Length: 304)

Name: NF4431_high_7
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4431_high_7
[»] chr2 (1 HSPs)
chr2 (1-293)||(26373141-26373432)
[»] scaffold1445 (1 HSPs)
scaffold1445 (130-244)||(1687-1796)

Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 26373432 - 26373141
1 cagactgcaggcaaatacacctgcttttattcgtacgcctctctcaaatcttggtatcctcataatccttactttattagctaccaagaatacaaattgt 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26373432 cagaatgcaggcaaatacacctgcttttattcgtacgcctctctcaa-tctcggtatcctcataatccttactttattagctaccaagaatacaaattgt 26373334  T
101 tgagctgatgttcagttcaccatgtcataaaaatagcttttaatgatgaatatagttacattatgactaaccaaatcattttgtggaataacaatttcag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
26373333 tgagctgatgttcagttcaccatgtcataaaaatagcttttaatgatgaatataattacattatgactaaccaaatcattttgtggaataacaatttcag 26373234  T
201 ctaatgccaaaagggtgcacaagaaccattttcaacataccaagttaaactagtattcaccacaaacattatatgcattccgtctattttcat 293  Q
     ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26373233 ttaatgccaaaaggttgcacaagaaccattttcaacataccaagttaaactagtattcaccacaaacattatatgcattccgtctattttcat 26373141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1445 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1445

Target: scaffold1445; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 130 - 244
Target Start/End: Complemental strand, 1796 - 1687
130 aaaatagcttttaatgatgaatata-gttacattatgactaaccaaatcattttgtggaataacaatttcagctaatgccaaaagggtgcacaagaacca 228  Q
    ||||||||||||| ||||||||||| ||||||||     |||||||||||||  |  ||||||| |||||||||  |||||||||| | |||||||||      
1796 aaaatagctttta-tgatgaatataagttacatt-----taaccaaatcattaagcagaataacgatttcagctggtgccaaaaggctccacaagaacat 1703  T
229 ttttcaacataccaag 244  Q
    |||||||| |||||||    
1702 ttttcaacctaccaag 1687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 37782 times since January 2019
Visitors: 1597