View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-10 (Length: 134)

Name: NF4435-Insertion-10
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435-Insertion-10
[»] chr6 (29 HSPs)
chr6 (10-134)||(4585629-4585754)
chr6 (16-134)||(4579431-4579550)
chr6 (10-134)||(4570965-4571090)
chr6 (12-134)||(4560501-4560624)
chr6 (13-134)||(4592227-4592349)
chr6 (10-134)||(4557118-4557243)
chr6 (14-134)||(4563708-4563829)
chr6 (14-134)||(4574305-4574426)
chr6 (12-134)||(4613732-4613855)
chr6 (17-134)||(4480693-4480811)
chr6 (23-134)||(4504411-4504523)
chr6 (12-134)||(4598166-4598289)
chr6 (23-134)||(3171747-3171859)
chr6 (33-134)||(4516337-4516439)
chr6 (23-134)||(4490369-4490481)
chr6 (17-134)||(4617022-4617140)
chr6 (10-98)||(4606941-4607030)
chr6 (17-134)||(4461123-4461241)
chr6 (23-122)||(4392052-4392152)
chr6 (17-132)||(4505857-4505973)
chr6 (17-111)||(4492955-4493050)
chr6 (17-134)||(4601789-4601907)
chr6 (23-134)||(4469809-4469921)
chr6 (23-134)||(4625957-4626069)
chr6 (36-132)||(4568072-4568172)
chr6 (23-111)||(4267203-4267292)
chr6 (23-134)||(4622148-4622260)
chr6 (23-72)||(4299816-4299866)
chr6 (83-134)||(4260168-4260219)
[»] chr8 (3 HSPs)
chr8 (12-130)||(20863861-20863980)
chr8 (17-132)||(1674226-1674342)
chr8 (10-134)||(16686281-16686406)
[»] chr5 (2 HSPs)
chr5 (17-132)||(28000115-28000231)
chr5 (23-111)||(24103005-24103094)
[»] scaffold0477 (1 HSPs)
scaffold0477 (23-133)||(4701-4812)
[»] scaffold0288 (1 HSPs)
scaffold0288 (23-134)||(3733-3845)
[»] chr3 (1 HSPs)
chr3 (17-122)||(1281114-1281220)
[»] chr7 (1 HSPs)
chr7 (23-72)||(3086426-3086476)

Alignment Details
Target: chr6 (Bit Score: 110; Significance: 8e-56; HSPs: 29)
Name: chr6

Target: chr6; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4585629 - 4585754
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
4585629 aggtttgattttatttaagcaaaacctccttaatcactttttccaagtttatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 4585728  T
109 ctcaattgccttttgcctcatcttct 134  Q
    ||| ||||||||||||||||||||||    
4585729 ctcgattgccttttgcctcatcttct 4585754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 4579431 - 4579550
16 gattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaat 114  Q
    |||||| ||| || || ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    
4579431 gattttgtttgagtaacacctccttaatcactttctccaagttcatgtatgaacagcctccaggtctcgtgtcctcctccaccttcttcttcaactcaat 4579530  T
115 tgccttttgcctcatcttct 134  Q
4579531 tgccttttgcctcatcttct 4579550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4570965 - 4571090
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     
4570965 aggtgtgattttatttaagcaaaacctccttaatcactttttccaagttcatgtatgaacaaccaccaggtctcgtgtcctcctccgccttcttcttcat 4571064  T
109 ctcaattgccttttgcctcatcttct 134  Q
    ||| |||   |||| |||||||||||    
4571065 ctccattatatttttcctcatcttct 4571090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 84; E-Value: 3e-40
Query Start/End: Original strand, 12 - 134
Target Start/End: Original strand, 4560501 - 4560624
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||| ||    
4560501 gtttgattttgtttaagcaacacctccttaatcactttctccaagttcatgtatgaacaacctccaggtctcgtgtacacctccgcctttttcttcagct 4560600  T
111 caattgccttttgcctcatcttct 134  Q
    | || |||||||||||||||||||    
4560601 ccatggccttttgcctcatcttct 4560624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 13 - 134
Target Start/End: Original strand, 4592227 - 4592349
13 tttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||||||||||||| |||||||| |||| ||| ||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||    
4592227 tttgattttatttaagcaacacctccttgatcaatttgtccaagttcatatatgaacaacctccaggtctcgtgttctcctctgccttcttcttcaactc 4592326  T
112 aattgccttttgcctcatcttct 134  Q
     |||||||||| |||||||||||    
4592327 gattgcctttttcctcatcttct 4592349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4557118 - 4557243
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||     
4557118 aggtttgattttgtttaagcaaaacctccttaatcactttttccaaattcatgtatgaacaaccaccaggtctcgtgtcctcctccgccttcgtcttcat 4557217  T
109 ctcaattgccttttgcctcatcttct 134  Q
    |||||||  ||||| || ||||||||    
4557218 ctcaattatctttttccacatcttct 4557243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 4563708 - 4563829
14 ttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactca 112  Q
    |||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||  |||||| | |||||||||||||||    
4563708 ttgattttgtttaagcaaaacctccttgatcactttgtccaagttcatgtatgaacaacctccagctctcgtgttttcctccactttcttcttcaactca 4563807  T
113 attgccttttgcctcatcttct 134  Q
    ||||||||||||| ||||||||    
4563808 attgccttttgccgcatcttct 4563829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 4574305 - 4574426
14 ttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactca 112  Q
    |||||||| ||||||||| ||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||| ||||| |||||||||||| ||||    
4574305 ttgattttgtttaagcaacacctccttaatcactttctccaagtttgtgtatgaacaacctccaggtctcgtgtccacctccaccttcttcttcagctca 4574404  T
113 attgccttttgcctcatcttct 134  Q
    || || ||||||||||||||||    
4574405 atggctttttgcctcatcttct 4574426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 12 - 134
Target Start/End: Complemental strand, 4613855 - 4613732
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||| ||||  ||||| || |||||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||    
4613855 gtttgattttgtttcagcagcacctcattgatcactttgtccaagttcatatatgaacaacctcctggtctcgtgtcctcctctgccttcttcttcaact 4613756  T
111 caattgccttttgcctcatcttct 134  Q
    ||||||||||||||||||| ||||    
4613755 caattgccttttgcctcattttct 4613732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4480693 - 4480811
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||| ||| ||||||||||||| ||     
4480693 attttgtttaagcaagacctccttaatcactttgtccaagttcatgtatgaacaaccaccaggtcttgtgtcctcctctgccatcttcttcaactccatg 4480792  T
116 gccttttgcctcatcttct 134  Q
    ||||||||| |||||||||    
4480793 gccttttgcttcatcttct 4480811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 73; E-Value: 9e-34
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 4504523 - 4504411
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||| |||| ||||||||||| ||||||||||||||||| || ||||||    
4504523 tttaagcaagacgtccttaatcactttgtccaagttcatgtatgaacaaccaccaagtcttgtgtcctcctctgccttcttcttcaactccatggccttt 4504424  T
122 tgcctcatcttct 134  Q
4504423 tgcctcatcttct 4504411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 12 - 134
Target Start/End: Original strand, 4598166 - 4598289
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||| | |||||| || ||||||||||||||||| || |||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |    
4598166 gtttgattctgtttaagaaacacctccttaatcactttctctaagttcatgtatgaacaacctccaagtctcgtttcctcctccgccttcatcttcaaat 4598265  T
111 caattgccttttgcctcatcttct 134  Q
    |||||| |||||||||||| ||||    
4598266 caattgtcttttgcctcattttct 4598289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 3171747 - 3171859
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||  ||| || |||||||| ||||||||||||||||| || ||| ||    
3171747 tttaagcaagacctccttaatcactttatccaagttcatgtatgaacaaccaccaaatcttgtatcctcctctgccttcttcttcaactccatggccctt 3171846  T
122 tgcctcatcttct 134  Q
3171847 tgcctcatcttct 3171859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 33 - 134
Target Start/End: Original strand, 4516337 - 4516439
33 acctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttttgcctcatct 131  Q
    |||||||||||||||||| |||||||||  ||||||||||| || ||||| ||||||||||| |||||||||||||| || || ||||||||||||||||    
4516337 acctccttaatcactttttccaagttcacatatgaacaaccacctggtcttgtgtcctcctctgccttcttcttcaattccatggccttttgcctcatct 4516436  T
132 tct 134  Q
4516437 tct 4516439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 4490481 - 4490369
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  || |||||||||||||| ||||||||||||||||||| ||| ||  |||||||||||||| | |||||||||||||||||  | ||||||    
4490481 tttaagcatgacatccttaatcactttgtccaagttcatgtatgaactaccaccgagtctcgtgtcctccgctgccttcttcttcaactccgtcgccttt 4490382  T
122 tgcctcatcttct 134  Q
4490381 tgcctcatcttct 4490369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4617022 - 4617140
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||| ||||| | ||||||||||||||||||||| || ||||| |||| |||||| ||||||||||||||||| ||     
4617022 attttgtttaagcaacacatccttaataactttgttcaagttcatgtatgaacaaccacctggtctagtgttctcctctgccttcttcttcaactccatg 4617121  T
116 gccttttgcctcatcttct 134  Q
    ||||||||| |||| ||||    
4617122 gccttttgcttcattttct 4617140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 4607030 - 4606941
10 aggtttgattttatttaagcaaaacctccttaatcac-ttttccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgcct 98  Q
    |||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||| |||| || |||||| ||||| |||||||||    
4607030 aggtttgattttgtttaagcaaaaccttcttaatcactttttccaagttcatgtatgaaaaaccacctggtctcttgtccccctccgcct 4606941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4461123 - 4461241
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||| ||||| ||||||||| ||||||||  |||||||||||| || ||||||||| |||||||||| || || ||     
4461123 attttgtttaagcaagacatccttaatgactttgtccaagttcttgtatgaaacacctccaggtctggtatcctcctccaccttcttcttgaattccatg 4461222  T
116 gccttttgcctcatcttct 134  Q
4461223 accttttgcctcatcttct 4461241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 23 - 122
Target Start/End: Complemental strand, 4392152 - 4392052
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| ||||||||||||| ||| |||||||||||| ||||| |||| |||||||  ||||||||||  ||||||||||||||||| || ||||||    
4392152 tttaagcaagacctccttaatcagtttgtccaagttcatgaatgaagaaccaccaggtcatgtgtcctcctttgccttcttcttcaactcgatcgccttt 4392053  T
122 t 122  Q
4392052 t 4392052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 4505857 - 4505973
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||| ||||| |||||||||||| |||||||||| |||||||| || |||||||  ||| |||| |||||||| ||     
4505857 attttgtttaagcaacacctccttaataactttgtccaagttcatgaatgaacaaccaccaggtcttgtatcctcctttgccctctttttcaactccatg 4505956  T
116 gccttttgcctcatctt 132  Q
     |||||| |||||||||    
4505957 acctttttcctcatctt 4505973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 4492955 - 4493050
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||| ||||||||| || ||||| |||||||| ||||||||||||||||||||||| ||||||   ||||||||||| |||||||| ||||||||    
4492955 attttgtttaagcaagacatccttgatcactttgtccaagttcatgtatgaacaaccaccaggtactgtgtcctcctctgccttctttttcaactc 4493050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4601789 - 4601907
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||| ||||| |||| |||| ||||||||||||| ||  |||| |||  |||||  ||| ||||||||||||| ||     
4601789 attttgtttaagcaacacctccttaataactttgtccaggttcttgtatgaacaaccacctagtctagtgctctcctttgccatcttcttcaactccatg 4601888  T
116 gccttttgcctcatcttct 134  Q
4601889 gccttttgcctcatcttct 4601907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4469809 - 4469921
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || |||||||| ||||| ||||||||| ||||||||  |||||||||||| || ||||||||| |||||||||| ||||| ||   ||||    
4469809 tttaagcaagacatccttaatgactttgtccaagttcttgtatgaaacacctccaggtctggtatcctcctccaccttcttcttgaactccatgatcttt 4469908  T
122 tgcctcatcttct 134  Q
    | |||||||||||    
4469909 tccctcatcttct 4469921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4625957 - 4626069
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || || ||||||| ||| ||||  ||||||||||||||||| || || ||  ||| |||||| ||||||||||||||||| || ||||||    
4625957 tttaagcaagacatcattaatcagtttatccatattcatgtatgaacaaccaccgggactaatgttctcctctgccttcttcttcaactccatggccttt 4626056  T
122 tgcctcatcttct 134  Q
4626057 tgcctcatcttct 4626069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 36 - 132
Target Start/End: Original strand, 4568072 - 4568172
36 tccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgc---cttcttcttcaactcaattgccttttgcctcatct 131  Q
    |||||||||||||| |||||||||||||||||| || | |||||||| ||||||| ||| ||   ||||||||||||||| |  ||||||||||||||||    
4568072 tccttaatcactttgtccaagttcatgtatgaagaatcaccaggtcttgtgtccttctctgccttcttcttcttcaactccacggccttttgcctcatct 4568171  T
132 t 132  Q
4568172 t 4568172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 4267292 - 4267203
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||  ||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||| ||| || |||||| ||||||||||    
4267292 tttaagcatgacctccttaataactttgtccaagttcatgtatgaaaaaccaccaggtcttgtgttctcttctgccttcctcttcaactc 4267203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4622148 - 4622260
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  ||||||||||| ||||| ||||||||  ||||||||||||| ||||| || ||   ||| || ||||||| ||||||||| || ||||||    
4622148 tttaagcatgacctccttaataactttgtccaagttgttgtatgaacaaccaccagggctggtcgtctcatctgccttctccttcaactccatggccttt 4622247  T
122 tgcctcatcttct 134  Q
    || ||||||||||    
4622248 tgtctcatcttct 4622260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 4299866 - 4299816
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacc 72  Q
    |||||||| |||||||||||| ||||| |||||||||||||| ||||||||    
4299866 tttaagcagaacctccttaataactttgtccaagttcatgtacgaacaacc 4299816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 83 - 134
Target Start/End: Complemental strand, 4260219 - 4260168
83 gtgtcctcctccgccttcttcttcaactcaattgccttttgcctcatcttct 134  Q
    |||| |||||| |||||| |||||||||| ||  ||||||||||||||||||    
4260219 gtgttctcctctgccttcctcttcaactccatgaccttttgcctcatcttct 4260168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 4e-33; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 20863980 - 20863861
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||| |||| | ||||| ||||||||||| ||||||||||||||||    
20863980 gtttgattttgtttaagcaacacctccttaatcactttgtccaagttcatatatgaaccaccttccggtcttgtgtcctcctctgccttcttcttcaact 20863881  T
111 caattgccttttgcctcatc 130  Q
    || ||| |||||||||||||    
20863880 catttgtcttttgcctcatc 20863861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 1674226 - 1674342
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||||||||| ||||||||||||||||||||||| || ||||| |||| |||||| |||||||||||||| || ||     
1674226 attttgtttaagcaacacttccttaatcactttgtccaagttcatgtatgaacaaccacctggtctagtgttctcctctgccttcttcttcaattccatg 1674325  T
116 gccttttgcctcatctt 132  Q
1674326 gccttttgcctcatctt 1674342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 16686406 - 16686281
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||| ||| || ||| ||||| | | ||     
16686406 aggtttgattttgtttaagcaaaacctccataatcactttttccaagttcatgtatgaacaaccaccaggtctcgggtcttcgtccaccttcatttgcag 16686307  T
109 ctcaattgccttttgcctcatcttct 134  Q
     ||||||  ||||| |||||||||||    
16686306 ttcaattatctttttcctcatcttct 16686281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 1e-26; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 17 - 132
Target Start/End: Complemental strand, 28000231 - 28000115
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||| ||| || |||||||||||||| ||||||||||||||||||||||| || ||||| |||| |||||| ||||| ||||||||||| ||     
28000231 attttgtttaaacaacacttccttaatcactttgtccaagttcatgtatgaacaaccacctggtctagtgttctcctctgcctttttcttcaactccatg 28000132  T
116 gccttttgcctcatctt 132  Q
28000131 gccttttgcctcatctt 28000115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 23 - 111
Target Start/End: Original strand, 24103005 - 24103094
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||  ||||||||||| ||||| |||||||||||||||||| |||| |||| ||| |||| ||| || ||||||||||| |||||    
24103005 tttaagcatgacctccttaataactttgtccaagttcatgtatgaaaaaccaccagatcttgtgttctcttctgccttcttcttgaactc 24103094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0477 (Bit Score: 60; Significance: 5e-26; HSPs: 1)
Name: scaffold0477

Target: scaffold0477; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 23 - 133
Target Start/End: Complemental strand, 4812 - 4701
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  ||||||||||||||||| |||||||||||||||||||| || ||||  || |||| |||||| ||||||||||||||||| || ||||||    
4812 tttaagcatgacctccttaatcactttgtccaagttcatgtatgaacagccaccagaactggtgttctcctctgccttcttcttcaactccatggccttt 4713  T
122 tgcctcatcttc 133  Q
4712 tgcctcatcttc 4701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288 (Bit Score: 57; Significance: 3e-24; HSPs: 1)
Name: scaffold0288

Target: scaffold0288; HSP #1
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 3845 - 3733
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||||||||||||||| ||||| |||| |||||||||||||| ||| || ||||| |||| |||||| ||||||||||| ||||| |  ||||||    
3845 tttaagcaaaacctccttaataactttgtccaggttcatgtatgaacgaccacctggtctagtgttctcctctgccttcttctttaactccacggccttt 3746  T
122 tgcctcatcttct 134  Q
3745 tgcctcatcttct 3733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 1281114 - 1281220
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| |  |||||||||||||| || |||||||||||||||||||| || ||||| |||| ||||||||||  ||||||||| || ||     
1281114 attttgtttaagcaacatttccttaatcactttgtcgaagttcatgtatgaacaaccacccggtctagtgttctcctccgccgccttcttcaattccatg 1281213  T
116 gcctttt 122  Q
1281214 gcctttt 1281220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 23 - 72
Target Start/End: Original strand, 3086426 - 3086476
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacc 72  Q
    ||||||||| ||||||||||| ||||| |||||||||||||||||||||||    
3086426 tttaagcaagacctccttaataactttgtccaagttcatgtatgaacaacc 3086476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295859 times since January 2019
Visitors: 3016