View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-10 (Length: 134)

Name: NF4435-Insertion-10
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-10
NF4435-Insertion-10
[»] chr6 (29 HSPs)
chr6 (10-134)||(4585629-4585754)
chr6 (16-134)||(4579431-4579550)
chr6 (10-134)||(4570965-4571090)
chr6 (12-134)||(4560501-4560624)
chr6 (13-134)||(4592227-4592349)
chr6 (10-134)||(4557118-4557243)
chr6 (14-134)||(4563708-4563829)
chr6 (14-134)||(4574305-4574426)
chr6 (12-134)||(4613732-4613855)
chr6 (17-134)||(4480693-4480811)
chr6 (23-134)||(4504411-4504523)
chr6 (12-134)||(4598166-4598289)
chr6 (23-134)||(3171747-3171859)
chr6 (33-134)||(4516337-4516439)
chr6 (23-134)||(4490369-4490481)
chr6 (17-134)||(4617022-4617140)
chr6 (10-98)||(4606941-4607030)
chr6 (17-134)||(4461123-4461241)
chr6 (23-122)||(4392052-4392152)
chr6 (17-132)||(4505857-4505973)
chr6 (17-111)||(4492955-4493050)
chr6 (17-134)||(4601789-4601907)
chr6 (23-134)||(4469809-4469921)
chr6 (23-134)||(4625957-4626069)
chr6 (36-132)||(4568072-4568172)
chr6 (23-111)||(4267203-4267292)
chr6 (23-134)||(4622148-4622260)
chr6 (23-72)||(4299816-4299866)
chr6 (83-134)||(4260168-4260219)
[»] chr8 (3 HSPs)
chr8 (12-130)||(20863861-20863980)
chr8 (17-132)||(1674226-1674342)
chr8 (10-134)||(16686281-16686406)
[»] chr5 (2 HSPs)
chr5 (17-132)||(28000115-28000231)
chr5 (23-111)||(24103005-24103094)
[»] scaffold0477 (1 HSPs)
scaffold0477 (23-133)||(4701-4812)
[»] scaffold0288 (1 HSPs)
scaffold0288 (23-134)||(3733-3845)
[»] chr3 (1 HSPs)
chr3 (17-122)||(1281114-1281220)
[»] chr7 (1 HSPs)
chr7 (23-72)||(3086426-3086476)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 8e-56; HSPs: 29)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4585629 - 4585754
Alignment:
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
4585629 aggtttgattttatttaagcaaaacctccttaatcactttttccaagtttatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 4585728  T
109 ctcaattgccttttgcctcatcttct 134  Q
    ||| ||||||||||||||||||||||    
4585729 ctcgattgccttttgcctcatcttct 4585754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 4579431 - 4579550
Alignment:
16 gattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaat 114  Q
    |||||| ||| || || ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    
4579431 gattttgtttgagtaacacctccttaatcactttctccaagttcatgtatgaacagcctccaggtctcgtgtcctcctccaccttcttcttcaactcaat 4579530  T
115 tgccttttgcctcatcttct 134  Q
    ||||||||||||||||||||    
4579531 tgccttttgcctcatcttct 4579550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4570965 - 4571090
Alignment:
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     
4570965 aggtgtgattttatttaagcaaaacctccttaatcactttttccaagttcatgtatgaacaaccaccaggtctcgtgtcctcctccgccttcttcttcat 4571064  T
109 ctcaattgccttttgcctcatcttct 134  Q
    ||| |||   |||| |||||||||||    
4571065 ctccattatatttttcctcatcttct 4571090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 84; E-Value: 3e-40
Query Start/End: Original strand, 12 - 134
Target Start/End: Original strand, 4560501 - 4560624
Alignment:
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||| ||    
4560501 gtttgattttgtttaagcaacacctccttaatcactttctccaagttcatgtatgaacaacctccaggtctcgtgtacacctccgcctttttcttcagct 4560600  T
111 caattgccttttgcctcatcttct 134  Q
    | || |||||||||||||||||||    
4560601 ccatggccttttgcctcatcttct 4560624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 13 - 134
Target Start/End: Original strand, 4592227 - 4592349
Alignment:
13 tttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||||||||||||| |||||||| |||| ||| ||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||    
4592227 tttgattttatttaagcaacacctccttgatcaatttgtccaagttcatatatgaacaacctccaggtctcgtgttctcctctgccttcttcttcaactc 4592326  T
112 aattgccttttgcctcatcttct 134  Q
     |||||||||| |||||||||||    
4592327 gattgcctttttcctcatcttct 4592349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 4557118 - 4557243
Alignment:
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||     
4557118 aggtttgattttgtttaagcaaaacctccttaatcactttttccaaattcatgtatgaacaaccaccaggtctcgtgtcctcctccgccttcgtcttcat 4557217  T
109 ctcaattgccttttgcctcatcttct 134  Q
    |||||||  ||||| || ||||||||    
4557218 ctcaattatctttttccacatcttct 4557243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 4563708 - 4563829
Alignment:
14 ttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactca 112  Q
    |||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||  |||||| | |||||||||||||||    
4563708 ttgattttgtttaagcaaaacctccttgatcactttgtccaagttcatgtatgaacaacctccagctctcgtgttttcctccactttcttcttcaactca 4563807  T
113 attgccttttgcctcatcttct 134  Q
    ||||||||||||| ||||||||    
4563808 attgccttttgccgcatcttct 4563829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 4574305 - 4574426
Alignment:
14 ttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactca 112  Q
    |||||||| ||||||||| ||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||| ||||| |||||||||||| ||||    
4574305 ttgattttgtttaagcaacacctccttaatcactttctccaagtttgtgtatgaacaacctccaggtctcgtgtccacctccaccttcttcttcagctca 4574404  T
113 attgccttttgcctcatcttct 134  Q
    || || ||||||||||||||||    
4574405 atggctttttgcctcatcttct 4574426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 12 - 134
Target Start/End: Complemental strand, 4613855 - 4613732
Alignment:
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||| ||||  ||||| || |||||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||    
4613855 gtttgattttgtttcagcagcacctcattgatcactttgtccaagttcatatatgaacaacctcctggtctcgtgtcctcctctgccttcttcttcaact 4613756  T
111 caattgccttttgcctcatcttct 134  Q
    ||||||||||||||||||| ||||    
4613755 caattgccttttgcctcattttct 4613732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4480693 - 4480811
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||| ||| ||||||||||||| ||     
4480693 attttgtttaagcaagacctccttaatcactttgtccaagttcatgtatgaacaaccaccaggtcttgtgtcctcctctgccatcttcttcaactccatg 4480792  T
116 gccttttgcctcatcttct 134  Q
    ||||||||| |||||||||    
4480793 gccttttgcttcatcttct 4480811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 73; E-Value: 9e-34
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 4504523 - 4504411
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||| |||| ||||||||||| ||||||||||||||||| || ||||||    
4504523 tttaagcaagacgtccttaatcactttgtccaagttcatgtatgaacaaccaccaagtcttgtgtcctcctctgccttcttcttcaactccatggccttt 4504424  T
122 tgcctcatcttct 134  Q
    |||||||||||||    
4504423 tgcctcatcttct 4504411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 12 - 134
Target Start/End: Original strand, 4598166 - 4598289
Alignment:
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||| | |||||| || ||||||||||||||||| || |||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |    
4598166 gtttgattctgtttaagaaacacctccttaatcactttctctaagttcatgtatgaacaacctccaagtctcgtttcctcctccgccttcatcttcaaat 4598265  T
111 caattgccttttgcctcatcttct 134  Q
    |||||| |||||||||||| ||||    
4598266 caattgtcttttgcctcattttct 4598289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 3171747 - 3171859
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||  ||| || |||||||| ||||||||||||||||| || ||| ||    
3171747 tttaagcaagacctccttaatcactttatccaagttcatgtatgaacaaccaccaaatcttgtatcctcctctgccttcttcttcaactccatggccctt 3171846  T
122 tgcctcatcttct 134  Q
    |||||||||||||    
3171847 tgcctcatcttct 3171859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 33 - 134
Target Start/End: Original strand, 4516337 - 4516439
Alignment:
33 acctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttttgcctcatct 131  Q
    |||||||||||||||||| |||||||||  ||||||||||| || ||||| ||||||||||| |||||||||||||| || || ||||||||||||||||    
4516337 acctccttaatcactttttccaagttcacatatgaacaaccacctggtcttgtgtcctcctctgccttcttcttcaattccatggccttttgcctcatct 4516436  T
132 tct 134  Q
    |||    
4516437 tct 4516439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 4490481 - 4490369
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  || |||||||||||||| ||||||||||||||||||| ||| ||  |||||||||||||| | |||||||||||||||||  | ||||||    
4490481 tttaagcatgacatccttaatcactttgtccaagttcatgtatgaactaccaccgagtctcgtgtcctccgctgccttcttcttcaactccgtcgccttt 4490382  T
122 tgcctcatcttct 134  Q
    |||||||||||||    
4490381 tgcctcatcttct 4490369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4617022 - 4617140
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||| ||||| | ||||||||||||||||||||| || ||||| |||| |||||| ||||||||||||||||| ||     
4617022 attttgtttaagcaacacatccttaataactttgttcaagttcatgtatgaacaaccacctggtctagtgttctcctctgccttcttcttcaactccatg 4617121  T
116 gccttttgcctcatcttct 134  Q
    ||||||||| |||| ||||    
4617122 gccttttgcttcattttct 4617140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 4607030 - 4606941
Alignment:
10 aggtttgattttatttaagcaaaacctccttaatcac-ttttccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgcct 98  Q
    |||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||| |||| || |||||| ||||| |||||||||    
4607030 aggtttgattttgtttaagcaaaaccttcttaatcactttttccaagttcatgtatgaaaaaccacctggtctcttgtccccctccgcct 4606941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4461123 - 4461241
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||| ||||| ||||||||| ||||||||  |||||||||||| || ||||||||| |||||||||| || || ||     
4461123 attttgtttaagcaagacatccttaatgactttgtccaagttcttgtatgaaacacctccaggtctggtatcctcctccaccttcttcttgaattccatg 4461222  T
116 gccttttgcctcatcttct 134  Q
     ||||||||||||||||||    
4461223 accttttgcctcatcttct 4461241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 23 - 122
Target Start/End: Complemental strand, 4392152 - 4392052
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| ||||||||||||| ||| |||||||||||| ||||| |||| |||||||  ||||||||||  ||||||||||||||||| || ||||||    
4392152 tttaagcaagacctccttaatcagtttgtccaagttcatgaatgaagaaccaccaggtcatgtgtcctcctttgccttcttcttcaactcgatcgccttt 4392053  T
122 t 122  Q
    |    
4392052 t 4392052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 4505857 - 4505973
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||| ||||| |||||||||||| |||||||||| |||||||| || |||||||  ||| |||| |||||||| ||     
4505857 attttgtttaagcaacacctccttaataactttgtccaagttcatgaatgaacaaccaccaggtcttgtatcctcctttgccctctttttcaactccatg 4505956  T
116 gccttttgcctcatctt 132  Q
     |||||| |||||||||    
4505957 acctttttcctcatctt 4505973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 4492955 - 4493050
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||| ||||||||| || ||||| |||||||| ||||||||||||||||||||||| ||||||   ||||||||||| |||||||| ||||||||    
4492955 attttgtttaagcaagacatccttgatcactttgtccaagttcatgtatgaacaaccaccaggtactgtgtcctcctctgccttctttttcaactc 4493050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 4601789 - 4601907
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| ||||||||||| ||||| |||| |||| ||||||||||||| ||  |||| |||  |||||  ||| ||||||||||||| ||     
4601789 attttgtttaagcaacacctccttaataactttgtccaggttcttgtatgaacaaccacctagtctagtgctctcctttgccatcttcttcaactccatg 4601888  T
116 gccttttgcctcatcttct 134  Q
    |||||||||||||||||||    
4601889 gccttttgcctcatcttct 4601907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4469809 - 4469921
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || |||||||| ||||| ||||||||| ||||||||  |||||||||||| || ||||||||| |||||||||| ||||| ||   ||||    
4469809 tttaagcaagacatccttaatgactttgtccaagttcttgtatgaaacacctccaggtctggtatcctcctccaccttcttcttgaactccatgatcttt 4469908  T
122 tgcctcatcttct 134  Q
    | |||||||||||    
4469909 tccctcatcttct 4469921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4625957 - 4626069
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||| || || ||||||| ||| ||||  ||||||||||||||||| || || ||  ||| |||||| ||||||||||||||||| || ||||||    
4625957 tttaagcaagacatcattaatcagtttatccatattcatgtatgaacaaccaccgggactaatgttctcctctgccttcttcttcaactccatggccttt 4626056  T
122 tgcctcatcttct 134  Q
    |||||||||||||    
4626057 tgcctcatcttct 4626069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 36 - 132
Target Start/End: Original strand, 4568072 - 4568172
Alignment:
36 tccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgc---cttcttcttcaactcaattgccttttgcctcatct 131  Q
    |||||||||||||| |||||||||||||||||| || | |||||||| ||||||| ||| ||   ||||||||||||||| |  ||||||||||||||||    
4568072 tccttaatcactttgtccaagttcatgtatgaagaatcaccaggtcttgtgtccttctctgccttcttcttcttcaactccacggccttttgcctcatct 4568171  T
132 t 132  Q
    |    
4568172 t 4568172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 4267292 - 4267203
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||  ||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||| ||| || |||||| ||||||||||    
4267292 tttaagcatgacctccttaataactttgtccaagttcatgtatgaaaaaccaccaggtcttgtgttctcttctgccttcctcttcaactc 4267203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 4622148 - 4622260
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  ||||||||||| ||||| ||||||||  ||||||||||||| ||||| || ||   ||| || ||||||| ||||||||| || ||||||    
4622148 tttaagcatgacctccttaataactttgtccaagttgttgtatgaacaaccaccagggctggtcgtctcatctgccttctccttcaactccatggccttt 4622247  T
122 tgcctcatcttct 134  Q
    || ||||||||||    
4622248 tgtctcatcttct 4622260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 4299866 - 4299816
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacc 72  Q
    |||||||| |||||||||||| ||||| |||||||||||||| ||||||||    
4299866 tttaagcagaacctccttaataactttgtccaagttcatgtacgaacaacc 4299816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 83 - 134
Target Start/End: Complemental strand, 4260219 - 4260168
Alignment:
83 gtgtcctcctccgccttcttcttcaactcaattgccttttgcctcatcttct 134  Q
    |||| |||||| |||||| |||||||||| ||  ||||||||||||||||||    
4260219 gtgttctcctctgccttcctcttcaactccatgaccttttgcctcatcttct 4260168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 4e-33; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 20863980 - 20863861
Alignment:
12 gtttgattttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaact 110  Q
    |||||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||| |||| | ||||| ||||||||||| ||||||||||||||||    
20863980 gtttgattttgtttaagcaacacctccttaatcactttgtccaagttcatatatgaaccaccttccggtcttgtgtcctcctctgccttcttcttcaact 20863881  T
111 caattgccttttgcctcatc 130  Q
    || ||| |||||||||||||    
20863880 catttgtcttttgcctcatc 20863861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 1674226 - 1674342
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| || |||||||||||||| ||||||||||||||||||||||| || ||||| |||| |||||| |||||||||||||| || ||     
1674226 attttgtttaagcaacacttccttaatcactttgtccaagttcatgtatgaacaaccacctggtctagtgttctcctctgccttcttcttcaattccatg 1674325  T
116 gccttttgcctcatctt 132  Q
    |||||||||||||||||    
1674326 gccttttgcctcatctt 1674342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 16686406 - 16686281
Alignment:
10 aggtttgattttatttaagcaaaacctccttaatcactttt-ccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaa 108  Q
    |||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||| ||| || ||| ||||| | | ||     
16686406 aggtttgattttgtttaagcaaaacctccataatcactttttccaagttcatgtatgaacaaccaccaggtctcgggtcttcgtccaccttcatttgcag 16686307  T
109 ctcaattgccttttgcctcatcttct 134  Q
     ||||||  ||||| |||||||||||    
16686306 ttcaattatctttttcctcatcttct 16686281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 1e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 17 - 132
Target Start/End: Complemental strand, 28000231 - 28000115
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||| ||| || |||||||||||||| ||||||||||||||||||||||| || ||||| |||| |||||| ||||| ||||||||||| ||     
28000231 attttgtttaaacaacacttccttaatcactttgtccaagttcatgtatgaacaaccacctggtctagtgttctcctctgcctttttcttcaactccatg 28000132  T
116 gccttttgcctcatctt 132  Q
    |||||||||||||||||    
28000131 gccttttgcctcatctt 28000115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 23 - 111
Target Start/End: Original strand, 24103005 - 24103094
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactc 111  Q
    ||||||||  ||||||||||| ||||| |||||||||||||||||| |||| |||| ||| |||| ||| || ||||||||||| |||||    
24103005 tttaagcatgacctccttaataactttgtccaagttcatgtatgaaaaaccaccagatcttgtgttctcttctgccttcttcttgaactc 24103094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0477 (Bit Score: 60; Significance: 5e-26; HSPs: 1)
Name: scaffold0477
Description:

Target: scaffold0477; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 23 - 133
Target Start/End: Complemental strand, 4812 - 4701
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||  ||||||||||||||||| |||||||||||||||||||| || ||||  || |||| |||||| ||||||||||||||||| || ||||||    
4812 tttaagcatgacctccttaatcactttgtccaagttcatgtatgaacagccaccagaactggtgttctcctctgccttcttcttcaactccatggccttt 4713  T
122 tgcctcatcttc 133  Q
    ||||||||||||    
4712 tgcctcatcttc 4701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288 (Bit Score: 57; Significance: 3e-24; HSPs: 1)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 3845 - 3733
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaattgccttt 121  Q
    ||||||||||||||||||||| ||||| |||| |||||||||||||| ||| || ||||| |||| |||||| ||||||||||| ||||| |  ||||||    
3845 tttaagcaaaacctccttaataactttgtccaggttcatgtatgaacgaccacctggtctagtgttctcctctgccttcttctttaactccacggccttt 3746  T
122 tgcctcatcttct 134  Q
    |||||||||||||    
3745 tgcctcatcttct 3733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 1281114 - 1281220
Alignment:
17 attttatttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacctccaggtctcgtgtcctcctccgccttcttcttcaactcaatt 115  Q
    ||||| ||||||||| |  |||||||||||||| || |||||||||||||||||||| || ||||| |||| ||||||||||  ||||||||| || ||     
1281114 attttgtttaagcaacatttccttaatcactttgtcgaagttcatgtatgaacaaccacccggtctagtgttctcctccgccgccttcttcaattccatg 1281213  T
116 gcctttt 122  Q
    |||||||    
1281214 gcctttt 1281220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 23 - 72
Target Start/End: Original strand, 3086426 - 3086476
Alignment:
23 tttaagcaaaacctccttaatcacttt-tccaagttcatgtatgaacaacc 72  Q
    ||||||||| ||||||||||| ||||| |||||||||||||||||||||||    
3086426 tttaagcaagacctccttaataactttgtccaagttcatgtatgaacaacc 3086476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125212 times since January 2019
Visitors: 1454