View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-11 (Length: 132)

Name: NF4435-Insertion-11
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435-Insertion-11
[»] chr7 (1 HSPs)
chr7 (8-132)||(2128886-2129010)

Alignment Details
Target: chr7 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 2129010 - 2128886
8 gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcgaccttagttacggatgttcgaaagcattgtgattgaggggaatgcaaagaaaga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
2129010 gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcaaccttagttacggatgtttgaaagcattgtgattgaggggaatgcaaagaaaga 2128911  T
108 gacattcatcaaactacatatcttt 132  Q
2128910 gacattcatcaaactacatatcttt 2128886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295633 times since January 2019
Visitors: 3016