View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-11 (Length: 132)

Name: NF4435-Insertion-11
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-11
NF4435-Insertion-11
[»] chr7 (1 HSPs)
chr7 (8-132)||(2128886-2129010)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 2129010 - 2128886
Alignment:
8 gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcgaccttagttacggatgttcgaaagcattgtgattgaggggaatgcaaagaaaga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
2129010 gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcaaccttagttacggatgtttgaaagcattgtgattgaggggaatgcaaagaaaga 2128911  T
108 gacattcatcaaactacatatcttt 132  Q
    |||||||||||||||||||||||||    
2128910 gacattcatcaaactacatatcttt 2128886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109841 times since January 2019
Visitors: 1349