View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-4 (Length: 623)

Name: NF4435-Insertion-4
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435-Insertion-4
[»] chr4 (3 HSPs)
chr4 (11-623)||(35607054-35607664)
chr4 (277-447)||(35617215-35617385)
chr4 (154-309)||(35617059-35617214)

Alignment Details
Target: chr4 (Bit Score: 529; Significance: 0; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 11 - 623
Target Start/End: Original strand, 35607054 - 35607664
11 accacgatgcaaatcaatgtttttaccggtgtttcaccccatttcagtagaggaacatacattggttacaaaatgtgggtgttgctctatgttggcggca 110  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
35607054 accacgatgcaaatcaatgtttttaccggtgcttcaccccatttcagtagaggaatatacattggttacaaaatgtgggtgttgctctatgttggcggca 35607153  T
111 ctgagctcggtgacaaaaataccgaggccaagtacttgcccgtttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagta 210  Q
    |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35607154 ctgagctcggtgacaaaaatactgaggccaagtactcgcccgtttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagta 35607253  T
211 atatatacatatgcatgccccaacaacaatcatactagaaagtgagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctaggatatc 310  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
35607254 atatatacatatgcatgccccagcaacaatcatactagcaagtgagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctacgatatc 35607353  T
311 taccagaagatgcaaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatccctgaaatggcctgattcacataacaaaaatagc 410  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35607354 taccagaagatgcgaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatccctgaaatggcctgattcacataacaaaaatagc 35607453  T
411 gagttaatgaccaacggtgaagaaaaatagttaccatgtatcatgtatgagaataaacaacttcnnnnnnnnnnnttaattaagaaaatcaatgtcagat 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||    
35607454 gagttaatgaccaacggtgaagaaaaatagttaccatgtatcatgtatgagaataaacaacttcaaaaaaaataa--aattaagaaaatcaatgtcagat 35607551  T
511 gccaattctatctgtagtggcttggcaaaccatggccagtctagtttttgaaaatagagctaccttctagattcaaatagatgcaaactaccacatgcca 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||    
35607552 gccaattctatctgtagtggcttggcaaaccatggccagtctagtttttgaaaatggagctaccttctagattcaaatagatgcaaactaccacgtgcca 35607651  T
611 gattagagagcac 623  Q
35607652 gattagagagcac 35607664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 277 - 447
Target Start/End: Original strand, 35617215 - 35617385
277 tgtcaaggaattgctgtagcatttctaggatatctaccagaagatgcaaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatc 376  Q
    ||||| || ||||||| |||||| ||||||||||||||||||||||| ||||  || ||| |||||| ||||||||||||||||||||||| ||||||||    
35617215 tgtcacgggattgctggagcattcctaggatatctaccagaagatgcgaatcgctgcagagttcgtggatgttcttgcttcaaacgtttattcgagaatc 35617314  T
377 cctgaaatggcctgattcacataacaaaaatagcgagttaatgaccaacggtgaagaaaaatagttaccat 447  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||    
35617315 cctgaaatggcctgattcacataacaaaaatagcaagttaatgaccaatgatgaagaaaaatagttaccat 35617385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 154 - 309
Target Start/End: Original strand, 35617059 - 35617214
154 ttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagtaatatatacatatgcatgccccaacaacaatcatactagaaagt 253  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||| |||||| || ||||    
35617059 ttaagttgaaatggtctcaacccaacagccaccacccttcacattgctgaatcagtaacatatacacatgcatgccccaacaacagtcataccagtaagt 35617158  T
254 gagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctaggatat 309  Q
    |||| | ||||||||||| ||  ||||| || ||||||| |||||| |||||||||    
35617159 gagactgaaaatcctgtttctcttgtcacgggattgctggagcattcctaggatat 35617214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 319171 times since January 2019
Visitors: 3040