View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-4 (Length: 623)

Name: NF4435-Insertion-4
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-4
NF4435-Insertion-4
[»] chr4 (3 HSPs)
chr4 (11-623)||(35607054-35607664)
chr4 (277-447)||(35617215-35617385)
chr4 (154-309)||(35617059-35617214)


Alignment Details
Target: chr4 (Bit Score: 529; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 11 - 623
Target Start/End: Original strand, 35607054 - 35607664
Alignment:
11 accacgatgcaaatcaatgtttttaccggtgtttcaccccatttcagtagaggaacatacattggttacaaaatgtgggtgttgctctatgttggcggca 110  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
35607054 accacgatgcaaatcaatgtttttaccggtgcttcaccccatttcagtagaggaatatacattggttacaaaatgtgggtgttgctctatgttggcggca 35607153  T
111 ctgagctcggtgacaaaaataccgaggccaagtacttgcccgtttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagta 210  Q
    |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35607154 ctgagctcggtgacaaaaatactgaggccaagtactcgcccgtttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagta 35607253  T
211 atatatacatatgcatgccccaacaacaatcatactagaaagtgagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctaggatatc 310  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
35607254 atatatacatatgcatgccccagcaacaatcatactagcaagtgagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctacgatatc 35607353  T
311 taccagaagatgcaaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatccctgaaatggcctgattcacataacaaaaatagc 410  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35607354 taccagaagatgcgaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatccctgaaatggcctgattcacataacaaaaatagc 35607453  T
411 gagttaatgaccaacggtgaagaaaaatagttaccatgtatcatgtatgagaataaacaacttcnnnnnnnnnnnttaattaagaaaatcaatgtcagat 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||    
35607454 gagttaatgaccaacggtgaagaaaaatagttaccatgtatcatgtatgagaataaacaacttcaaaaaaaataa--aattaagaaaatcaatgtcagat 35607551  T
511 gccaattctatctgtagtggcttggcaaaccatggccagtctagtttttgaaaatagagctaccttctagattcaaatagatgcaaactaccacatgcca 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||    
35607552 gccaattctatctgtagtggcttggcaaaccatggccagtctagtttttgaaaatggagctaccttctagattcaaatagatgcaaactaccacgtgcca 35607651  T
611 gattagagagcac 623  Q
    |||||||||||||    
35607652 gattagagagcac 35607664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 277 - 447
Target Start/End: Original strand, 35617215 - 35617385
Alignment:
277 tgtcaaggaattgctgtagcatttctaggatatctaccagaagatgcaaatccttgaagaattcgtgaatgttcttgcttcaaacgtttatacgagaatc 376  Q
    ||||| || ||||||| |||||| ||||||||||||||||||||||| ||||  || ||| |||||| ||||||||||||||||||||||| ||||||||    
35617215 tgtcacgggattgctggagcattcctaggatatctaccagaagatgcgaatcgctgcagagttcgtggatgttcttgcttcaaacgtttattcgagaatc 35617314  T
377 cctgaaatggcctgattcacataacaaaaatagcgagttaatgaccaacggtgaagaaaaatagttaccat 447  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||    
35617315 cctgaaatggcctgattcacataacaaaaatagcaagttaatgaccaatgatgaagaaaaatagttaccat 35617385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 154 - 309
Target Start/End: Original strand, 35617059 - 35617214
Alignment:
154 ttaagttgaaatggtcccaacccaacagccaccacccttcacattgttgaatcagtaatatatacatatgcatgccccaacaacaatcatactagaaagt 253  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||| |||||| || ||||    
35617059 ttaagttgaaatggtctcaacccaacagccaccacccttcacattgctgaatcagtaacatatacacatgcatgccccaacaacagtcataccagtaagt 35617158  T
254 gagattaaaaatcctgttacttctgtcaaggaattgctgtagcatttctaggatat 309  Q
    |||| | ||||||||||| ||  ||||| || ||||||| |||||| |||||||||    
35617159 gagactgaaaatcctgtttctcttgtcacgggattgctggagcattcctaggatat 35617214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125486 times since January 2019
Visitors: 1459