View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-6 (Length: 366)

Name: NF4435-Insertion-6
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-6
NF4435-Insertion-6
[»] chr2 (8 HSPs)
chr2 (7-366)||(11933716-11934075)
chr2 (9-366)||(11946937-11947294)
chr2 (66-366)||(11917545-11917845)
chr2 (182-351)||(8338565-8338734)
chr2 (179-360)||(11821194-11821375)
chr2 (179-354)||(11834989-11835164)
chr2 (224-257)||(35538966-35538999)
chr2 (272-348)||(11811394-11811470)
[»] chr4 (15 HSPs)
chr4 (182-352)||(36107939-36108109)
chr4 (190-352)||(21482671-21482833)
chr4 (180-363)||(38090672-38090855)
chr4 (182-352)||(36100680-36100850)
chr4 (182-352)||(34971536-34971706)
chr4 (191-351)||(36080076-36080236)
chr4 (194-354)||(38125515-38125675)
chr4 (182-330)||(36090226-36090374)
chr4 (194-363)||(38061847-38062016)
chr4 (194-324)||(37954139-37954269)
chr4 (194-360)||(38129462-38129628)
chr4 (194-307)||(38058494-38058607)
chr4 (194-306)||(38081908-38082020)
chr4 (191-363)||(38086276-38086448)
chr4 (191-294)||(38072835-38072938)
[»] chr6 (1 HSPs)
chr6 (182-352)||(6838700-6838870)
[»] chr3 (3 HSPs)
chr3 (219-261)||(2152495-2152537)
chr3 (219-261)||(2176154-2176196)
chr3 (219-257)||(2196698-2196736)


Alignment Details
Target: chr2 (Bit Score: 352; Significance: 0; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 7 - 366
Target Start/End: Complemental strand, 11934075 - 11933716
Alignment:
7 agcattttgtgtaacatttacaacatcaataataagcctaatgaataggtcattatcaatagttggtgctacatgttgccaattataaactatgtcactt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11934075 agcattttgtgtaacatttacaacatcaataataagcctaatgaataggtcattatcaatagttggtgctacatgttgccaattataaactatgtcactt 11933976  T
107 gcattttggtccaaagtttttctaatttgaaaaacagttactattttaggaactttaactaacttgattttgtaagaaagaacaacaccaaagctagctc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11933975 gcattttggtccaaagtttttctaatttgaaaaacagttactattttaggaactttaactaacttgattttgtaagaaagaacaacaccaaagctagctc 11933876  T
207 caccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcatcgataatattatc 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
11933875 caccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatctaccattaacatcgattatttgtgcatcgataatattatc 11933776  T
307 aactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcctcc 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11933775 aactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcctcc 11933716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 9 - 366
Target Start/End: Complemental strand, 11947294 - 11946937
Alignment:
9 cattttgtgtaacatttacaacatcaataataagcctaatgaataggtcattatcaatagttggtgctacatgttgccaattataaactatgtcacttgc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11947294 cattttgtgtaacatttacaacatcaataataagcctaatgaataggtcattatcaatagttggtgctacatgttgccaattataaactatgtcacttgc 11947195  T
109 attttggtccaaagtttttctaatttgaaaaacagttactattttaggaactttaactaacttgattttgtaagaaagaacaacaccaaagctagctcca 208  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
11947194 attttgttccaaagtttttctaatttgaaaaacagttactattttatgaactttaactaacttgattttgtaagaaagaacaacaccaaagctagctcca 11947095  T
209 ccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcatcgataatattatcaa 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
11947094 ccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatctaccattaacatcgattatttgtgcatcgataatattatcaa 11946995  T
309 ctgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcctcc 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11946994 ctgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcctcc 11946937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 66 - 366
Target Start/End: Complemental strand, 11917845 - 11917545
Alignment:
66 tagttggtgctacatgttgccaattataaactatgtcacttgcattttggtccaaagtttttctaatttgaaaaacagttactattttaggaactttaac 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||  || || ||||||||||||||| ||||||||||||||    
11917845 tagttggtgctacatgttgccaattataaactatgtcacttgcattttgttccaaagttctttgaacttcaaaaacagttactatcttaggaactttaac 11917746  T
166 taacttgattttgtaagaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaat 265  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||    
11917745 taacttgattttgtaagaaagaacaacaccaaagttagctccaccaccacctcttatagcccaaaaaagatcttctcccattgattttctatcaagcaat 11917646  T
266 ccaccattaacatcaattatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcctc 365  Q
    | ||| |||   || |||||||  || || | || ||||||   ||||  ||||||||||||||||| ||||||||| ||| ||||||| | ||||||||    
11917645 ctacctttagagtcgattatttcagcgtccaaaacattatcggttgaagtaccatattttctcatcaagttaccataaccagcaccactaacatgtcctc 11917546  T
366 c 366  Q
    |    
11917545 c 11917545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 182 - 351
Target Start/End: Complemental strand, 8338734 - 8338565
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||  ||||||||||||| |||||||||||||||||||||||||||||      |||||| |||||||    
8338734 gaaagaataacaccaaaactagcaccaccaccacccctaatagcccaaaacagatcttctcccattgattttctatcaagagtattaccattgacatcaa 8338635  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacc 351  Q
    | |||| ||| || || ||||||||||| ||||||||| | ||||||||||  || ||||| ||||||||    
8338634 taatttttgcgtcaatgatattatcaacagaaagaccaaactttctcatcaaatttccatacccaccacc 8338565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 179 - 360
Target Start/End: Complemental strand, 11821375 - 11821194
Alignment:
179 taagaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacat 278  Q
    ||||| ||||||||||| || ||||| ||||||||||||   |||||||||||||||||||| ||||||||||| ||||  |  |  | ||| |||||||    
11821375 taagacagaacaacaccgaaactagcaccaccaccacctagtatagcccaaaaaagatcttcacccattgatttcctattcaaaagcctacccttaacat 11821276  T
279 caattatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatg 360  Q
    |||  ||||  ||||| |||||||||||||| || | ||||||||||| || |||  ||||||| || |||||||| |||||    
11821275 caacaatttcagcatcaataatattatcaacagataaaccatattttcgcaacattgtaccataccctccaccactgaaatg 11821194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 179 - 354
Target Start/End: Original strand, 11834989 - 11835164
Alignment:
179 taagaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacat 278  Q
    ||||| |||||||||||||| ||||| |||||||| |||   |||||||||||||||||||| ||||||||||| ||||  |  |  |  || |||||||    
11834989 taagacagaacaacaccaaaactagcaccaccaccgcctcgtatagcccaaaaaagatcttcacccattgatttcctattcaaaagccttcccttaacat 11835088  T
279 caattatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccact 354  Q
    |||  ||||  ||||| |||||||||||||| || | |||||||||||||| |||   |||||| || ||||||||    
11835089 caacaatttcagcatcaataatattatcaacagataaaccatattttctcaacattgcaccataccctccaccact 11835164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 257
Target Start/End: Complemental strand, 35538999 - 35538966
Alignment:
224 gcccaaaaaagatcttctcccattgattttctat 257  Q
    |||||||||| |||||||||||||||||||||||    
35538999 gcccaaaaaatatcttctcccattgattttctat 35538966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 348
Target Start/End: Original strand, 11811394 - 11811470
Alignment:
272 ttaacatcaattatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccacc 348  Q
    |||||||| |||||||| ||||| || |||||||||  || ||||||||||||||| |  ||| ||||| |||||||    
11811394 ttaacatcgattatttgagcatcaattatattatcagttgcaagaccatattttctaaatatggtaccaaatccacc 11811470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 91; Significance: 5e-44; HSPs: 15)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 182 - 352
Target Start/End: Complemental strand, 36108109 - 36107939
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |    ||| ||||||||||    
36108109 gaaagaataacaccaaaactagcaccaccaccacctcttatagcccaaaaaagatcttctcccattgattttctatcaagaatattacccttaacatcaa 36108010  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacca 352  Q
      |||| |||||| |||||||||||||| ||||||||| ||||||||||||  |||||||| |||||||||    
36108009 ccatttttgcatcaataatattatcaacagaaagaccaaattttctcatcaaattaccatacccaccacca 36107939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 190 - 352
Target Start/End: Complemental strand, 21482833 - 21482671
Alignment:
190 aacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgt 289  Q
    ||||||| | ||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |    |||||| |||||||  |||| |    
21482833 aacaccataactagcaccaccaccacctcttatagcccaaaaaagatcttctcccattgattttctatcaaggatattaccattcacatcaacaattttt 21482734  T
290 gcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacca 352  Q
    || || |||||||||||||| ||||||||| ||||||||||||| || |||||||||||||||    
21482733 gcgtcaataatattatcaacagaaagaccaaattttctcatcatatttccatatccaccacca 21482671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 180 - 363
Target Start/End: Complemental strand, 38090855 - 38090672
Alignment:
180 aagaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatc 279  Q
    |||||| || ||||||||| |||||||||||||||||| ||||||||||||||| |||||| ||||||||||  |||||||||| ||  |||| ||||||    
38090855 aagaaacaataacaccaaaactagctccaccaccacctctaatagcccaaaaaacatcttcccccattgattccctatcaagcactcttccatcaacatc 38090756  T
280 aattatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcc 363  Q
    ||  || |  ||||| | |||||||||||| || |  ||| |||||||||||||||||||||| || |||||||| ||||||||    
38090755 aacaatcttagcatccaaaatattatcaacagataacccaaattttctcatcatgttaccataccccccaccactaaaatgtcc 38090672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 182 - 352
Target Start/End: Complemental strand, 36100850 - 36100680
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||  | ||||||||||| ||||||||||||||||| ||||||||||| |    |||||| |||||||    
36100850 gaaagaataacaccaaaactagcaccaccaccaccccttatagcccaaaatagatcttctcccattgactttctatcaaggatattaccattgacatcaa 36100751  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacca 352  Q
      |||| |||||| || ||||||||||  ||||||||| ||||||||||||  |||||||| |||||||||    
36100750 caatttttgcatcaatgatattatcaatagaaagaccaaattttctcatcaaattaccatacccaccacca 36100680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 182 - 352
Target Start/End: Original strand, 34971536 - 34971706
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||| | ||||||||||| ||||||||||||||||| ||||||||||| |    |||||| |||||||    
34971536 gaaagaataacaccaaaactagcaccaccaccacctctgatagcccaaaagagatcttctcccattgactttctatcaagaatattaccattgacatcaa 34971635  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacca 352  Q
      |||| ||| || || ||||||||||  ||||||||| ||||||||||||  || ||||| |||||||||    
34971636 caatttttgcgtcaatgatattatcaatagaaagaccaaattttctcatcaaatttccataaccaccacca 34971706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 191 - 351
Target Start/End: Complemental strand, 36080236 - 36080076
Alignment:
191 acaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtg 290  Q
    |||||||| || || |||||||||||  | ||||||||||| | ||||||||||||||||||||||||||| |  | ||||||||||||||  |||| ||    
36080236 acaccaaaacttgcaccaccaccaccccttatagcccaaaataaatcttctcccattgattttctatcaagaatactaccattaacatcaacaatttttg 36080137  T
291 catcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacc 351  Q
    | || || ||||||||||| || |||||| |||||||||| |  |||||||| ||||||||    
36080136 cgtcaattatattatcaacagatagaccaaattttctcattaaattaccataaccaccacc 36080076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 194 - 354
Target Start/End: Complemental strand, 38125675 - 38125515
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatcc-accattaacatcaattatttgtgca 292  Q
    ||||| || ||||| ||||| ||| |||||||||||||||| ||||| ||||||||||| |||||||| ||||| ||||||||||||||  ||||  |||    
38125675 ccaaaacttgctcctccacctcctctaatagcccaaaaaagttcttcacccattgatttcctatcaag-aatcctaccattaacatcaacaatttcagca 38125577  T
293 tcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccact 354  Q
    || | || ||||||||  || |  ||| |||||||||||||||||||||| || ||||||||    
38125576 tcaacaacattatcaatagacaacccaaattttctcatcatgttaccataccctccaccact 38125515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 182 - 330
Target Start/End: Original strand, 36090226 - 36090374
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||| | ||||||||||||||||||| | | |||||| |||||||||| |    |||||| ||||| |    
36090226 gaaagaataacaccaaaactagccccaccaccacctcttatagcccaaaaaagatctttttctattgatcttctatcaaggatattaccattgacatcga 36090325  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcat 330  Q
      |||| |||||| ||  |||||||||  ||||||||| ||||||||||    
36090326 caatttttgcatcaatggtattatcaatagaaagaccaaattttctcat 36090374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 194 - 363
Target Start/End: Original strand, 38061847 - 38062016
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcat 293  Q
    ||||| || ||||| ||||| ||| ||||||||||||||| ||| || ||||||| || ||| ||||| || | ||| || ||||||||||| || ||||    
38061847 ccaaaacttgctcctccacctcctctaatagcccaaaaaaaatcctcacccattgcttctctgtcaagaaacctacccttcacatcaattatgtgagcat 38061946  T
294 cgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcc 363  Q
    | |||||||||||| ||| ||||||  |||| | || || ||| ||||| ||||||||||| || |||||    
38061947 caataatattatcagctgcaagaccgaatttacgcaccaagtttccatagccaccaccactgaagtgtcc 38062016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 194 - 324
Target Start/End: Complemental strand, 37954269 - 37954139
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcat 293  Q
    |||||||| ||||| ||||| ||| ||||||||||||| ||||| || ||||| |||| ||| ||||| |  | |||||| ||||||||||| || || |    
37954269 ccaaagcttgctcctccacctcctctaatagcccaaaacagatcctcacccatcgattctctgtcaagaaccctaccattcacatcaattatgtgagcgt 37954170  T
294 cgataatattatcaactgaaagaccatattt 324  Q
    | |  ||||||||| ||||||||||||||||    
37954169 caagtatattatcagctgaaagaccatattt 37954139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 194 - 360
Target Start/End: Complemental strand, 38129628 - 38129462
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcat 293  Q
    ||||| || ||||| ||||| ||| |||||||||||||||||||||| ||||| | |||  | ||||| | || |||||| |||||||| ||||  ||||    
38129628 ccaaaacttgctcctccacctcctctaatagcccaaaaaagatcttcccccatagttttcttgtcaagaattctaccattgacatcaataattttagcat 38129529  T
294 cgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatg 360  Q
    | | |||||||||||  || |  ||  |||||||||||||||||||||| || || ||||| |||||    
38129528 caacaatattatcaatagataacccgaattttctcatcatgttaccataccctcctccactcaaatg 38129462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 307
Target Start/End: Complemental strand, 38058607 - 38058494
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcat 293  Q
    ||||| || ||||| ||||||||| ||||||||||||| | |||||| ||||||| || ||| ||||| || | ||| || ||||||||||| || ||||    
38058607 ccaaaacttgctcctccaccacctctaatagcccaaaacaaatcttcacccattgcttctctgtcaagaaacctacccttcacatcaattatgtgagcat 38058508  T
294 cgataatattatca 307  Q
    | || |||||||||    
38058507 caattatattatca 38058494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 194 - 306
Target Start/End: Complemental strand, 38082020 - 38081908
Alignment:
194 ccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtgcat 293  Q
    ||||| || ||||| ||||||||| ||||||||||||||  |||||| ||||||| || ||| ||||| || | ||| || ||||||||||| || ||||    
38082020 ccaaaacttgctcctccaccacctctaatagcccaaaaataatcttcacccattgcttctctgtcaagtaacctacctttcacatcaattatgtgagcat 38081921  T
294 cgataatattatc 306  Q
    |||| | ||||||    
38081920 cgattacattatc 38081908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 363
Target Start/End: Complemental strand, 38086448 - 38086276
Alignment:
191 acaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtg 290  Q
    |||||||| || ||||| ||||||||| ||||||||||||| | ||| || ||||||| || ||| ||||| || | ||| || ||||||||||| |  |    
38086448 acaccaaaacttgctcctccaccacctctaatagcccaaaagaaatcctcacccattgcttctctgtcaagaaacctacccttcacatcaattatgtagg 38086349  T
291 catcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccaccacttaaatgtcc 363  Q
    |||| || || |||||  ||| |||||| ||||| | || || | | ||||||||||||||||| || |||||    
38086348 catcaatgatgttatcggctgcaagaccgtatttacgcaacaaggttccatatccaccaccactgaagtgtcc 38086276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 191 - 294
Target Start/End: Complemental strand, 38072938 - 38072835
Alignment:
191 acaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaattatttgtg 290  Q
    |||||||| || ||||| ||||||||| ||||||||||||| | |||||| ||||||| || ||| ||||| || | ||| || ||||||||||| || |    
38072938 acaccaaaacttgctcctccaccacctctaatagcccaaaacaaatcttcacccattgcttctctgtcaagaaacctacccttcacatcaattatgtgag 38072839  T
291 catc 294  Q
    ||||    
38072838 catc 38072835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 182 - 352
Target Start/End: Complemental strand, 6838870 - 6838700
Alignment:
182 gaaagaacaacaccaaagctagctccaccaccacctttaatagcccaaaaaagatcttctcccattgattttctatcaagcaatccaccattaacatcaa 281  Q
    ||||||| ||||||||| ||||| |||||||||||| | || |||||||||||||||||||||||||||||||||||||| |    ||| ||||||||||    
6838870 gaaagaataacaccaaaactagcaccaccaccacctcttatggcccaaaaaagatcttctcccattgattttctatcaagaatattacccttaacatcaa 6838771  T
282 ttatttgtgcatcgataatattatcaactgaaagaccatattttctcatcatgttaccatatccaccacca 352  Q
      |||| ||| || |||||||||||||  ||||||||| ||||||||||||  || ||||| |||||||||    
6838770 caatttttgcgtcaataatattatcaatagaaagaccaaattttctcatcaaatttccatacccaccacca 6838700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 2152537 - 2152495
Alignment:
219 taatagcccaaaaaagatcttctcccattgattttctatcaag 261  Q
    ||||||||||||||| |||||||||||||||||||||||||||    
2152537 taatagcccaaaaaacatcttctcccattgattttctatcaag 2152495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 2176196 - 2176154
Alignment:
219 taatagcccaaaaaagatcttctcccattgattttctatcaag 261  Q
    ||||||||||||||| |||||||||||||||||||||||||||    
2176196 taatagcccaaaaaacatcttctcccattgattttctatcaag 2176154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 257
Target Start/End: Complemental strand, 2196736 - 2196698
Alignment:
219 taatagcccaaaaaagatcttctcccattgattttctat 257  Q
    |||| |||||||||| |||||||||||||||||||||||    
2196736 taatggcccaaaaaacatcttctcccattgattttctat 2196698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109823 times since January 2019
Visitors: 1349