View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-7 (Length: 305)

Name: NF4435-Insertion-7
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-7
NF4435-Insertion-7
[»] chr8 (2 HSPs)
chr8 (8-305)||(592196-592493)
chr8 (8-305)||(579935-580231)


Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 305
Target Start/End: Complemental strand, 592493 - 592196
Alignment:
8 ggtataataatggtatcaaacttctgagacttgattgttggttactttatgttgataattgtaaattcctctcttgcaacnnnnnnnggctgtgttgttt 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |       |||||||||||||    
592493 ggtataataatggtatcaaacttctgagacttgattgtttgttactttatgttgataattgtaaattcctctcttgcagctttctttggctgtgttgttt 592394  T
108 tctgaaacatgaaccaaatttacaggactatttctcaaagtggggatcaagcggtgaagttgatttgaagtatgagcttgagcatctgatcatcttgaca 207  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
592393 tctcaaacatgaaccaaatttacaggactatttctcaaagtggggatcaagcggtgaagttgatttgaagtatgagcttgagcatctgatcatcttgaca 592294  T
208 accagtagatgccttttgggtcgtgaagttcgtgacaagctcttcgatgatgtctctgcattgttccacgatctcgatgacggaatgcttccaatcag 305  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||    
592293 gccagtagatgccttttgggtcgtgaagttcgtgacaagctcttcgatgatgtctctgcattgttccacgatctcgataatggaatgcttccaatcag 592196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 305
Target Start/End: Original strand, 579935 - 580231
Alignment:
8 ggtataataatggtatcaaacttctgagacttgattgttggttactttatgttgataattgtaaattcctctcttgcaacnnnnnnnggctgtgttgttt 107  Q
    ||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||         ||||||| |||    
579935 ggtataataatggtatcaaacctctgagacttgattgtttgtttctttatgttgataattgtaaattcctctcttgcaactttctttcactgtgttattt 580034  T
108 tctgaaacatgaaccaaatttacaggactatttctcaaagtggggatcaagcggtgaagttgatttgaagtatgagcttgagcatctgatcatcttgaca 207  Q
     || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
580035 -ctcaaacatgaaccaaatttacaggactatttctcaaagtggggatcaagcggtgaagttgatttgaagtatgagcttgagcatctgatcatcttgaca 580133  T
208 accagtagatgccttttgggtcgtgaagttcgtgacaagctcttcgatgatgtctctgcattgttccacgatctcgatgacggaatgcttccaatcag 305  Q
     |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
580134 gccagtagatgtctcttgggtcgtgaagttcgtgacaagctcttcgatgatgtctctgcattgttccacgatctcgataacggaatgcttccaatcag 580231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37724 times since January 2019
Visitors: 1597