View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-8 (Length: 273)

Name: NF4435-Insertion-8
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-8
NF4435-Insertion-8
[»] chr4 (2 HSPs)
chr4 (7-273)||(31321674-31321940)
chr4 (7-273)||(31333927-31334193)
[»] chr7 (1 HSPs)
chr7 (82-240)||(39110404-39110562)
[»] chr1 (2 HSPs)
chr1 (67-237)||(33521062-33521232)
chr1 (208-264)||(10926283-10926339)


Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 273
Target Start/End: Original strand, 31321674 - 31321940
Alignment:
7 aattgaagagtttatagatagtgtttatccaatggaaggagcattgtcgccaggtgagaattggaatttgtatacttctgctcatcaaatggggagttgt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31321674 aattgaagagtttatagatagtgtttatccaatggaaggagcattgtggccaggtgagaattggaatttgtatacttctgctcatcaaatggggagttgt 31321773  T
107 agaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtttgtgatgctagtgttcttccaactg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31321774 agaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtttgtgatgctagtgttcttccaactg 31321873  T
207 ctgttggtgttaatcctatgattactattcaatcaactgcattttgtatttcaaataggattgtaga 273  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31321874 ctgttggtgttaatcctatgatcactattcaatcaactgcattttgtatttcaaataggattgtaga 31321940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 273
Target Start/End: Original strand, 31333927 - 31334193
Alignment:
7 aattgaagagtttatagatagtgtttatccaatggaaggagcattgtcgccaggtgagaattggaatttgtatacttctgctcatcaaatggggagttgt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31333927 aattgaagagtttatagatagtgtttatccaatggaaggagcattgtggccaggtgagaattggaatttgtatacttctgctcatcaaatggggagttgt 31334026  T
107 agaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtttgtgatgctagtgttcttccaactg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31334027 agaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtttgtgatgctagtgttcttccaactg 31334126  T
207 ctgttggtgttaatcctatgattactattcaatcaactgcattttgtatttcaaataggattgtaga 273  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31334127 ctgttggtgttaatcctatgatcactattcaatcaactgcattttgtatttcaaataggattgtaga 31334193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 82 - 240
Target Start/End: Original strand, 39110404 - 39110562
Alignment:
82 ttctgctcatcaaatggggagttgtagaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtt 181  Q
    |||||| ||||||||||| ||||||||||||||   ||||||| | || ||||| |||||||| ||||| || |||||||||||  ||||||||| |||     
39110404 ttctgcacatcaaatgggaagttgtagaatgggtaagaatgaagaagagggtgcagttgatgagaatggagaaagttgggaagcaaaagggttgtatgtg 39110503  T
182 tgtgatgctagtgttcttccaactgctgttggtgttaatcctatgattactattcaatc 240  Q
    |||||||  |||||| | || | ||| ||||||||||| |||||| | || ||||||||    
39110504 tgtgatggaagtgttttgcctagtgcagttggtgttaaccctatggtaaccattcaatc 39110562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 67 - 237
Target Start/End: Complemental strand, 33521232 - 33521062
Alignment:
67 ttggaatttgtatacttctgctcatcaaatggggagttgtagaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagct 166  Q
    ||||||| ||||| | |||||||| || |||||||||||||| || ||| | | ||| ||||||||  | ||||||||||||||  ||| ||||||||||    
33521232 ttggaatatgtatgcatctgctcaccagatggggagttgtaggataggaatcactgataaggaaggcacggttgatgaaaatggacagaattgggaagct 33521133  T
167 gaagggttgtttgtttgtgatgctagtgttcttccaactgctgttggtgttaatcctatgattactattca 237  Q
    |||||  | ||||| |||||||| ||| |  ||||||||||  | ||| | ||||| ||||| ||||||||    
33521132 gaaggactatttgtgtgtgatgcaagtttgtttccaactgccataggtatcaatcccatgataactattca 33521062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 208 - 264
Target Start/End: Original strand, 10926283 - 10926339
Alignment:
208 tgttggtgttaatcctatgattactattcaatcaactgcattttgtatttcaaatag 264  Q
    |||| ||||||||||| | || |||||||||||||||||||||||||||||||||||    
10926283 tgttagtgttaatcctctaataactattcaatcaactgcattttgtatttcaaatag 10926339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175797 times since January 2019
Visitors: 2679