View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435-Insertion-9 (Length: 212)

Name: NF4435-Insertion-9
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435-Insertion-9
NF4435-Insertion-9
[»] chr4 (1 HSPs)
chr4 (8-212)||(47225454-47225658)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 47225454 - 47225658
Alignment:
8 ctttgtaccccactaaagatcatcaatttgcatgaaatgggtccagcctttccttgctttgctcatcatgtttttgctattgggatatgctttcaaagag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47225454 ctttgtaccccactaaagatcatcaatttgcatgaaatgggtccaacctttccttgctttgctcatcatgtttttgctattgggatatgctttcaaagag 47225553  T
108 cattatcttgtctcttagggttcannnnnnnaaatggttgtaaagcatggtggaaattttaggtttagttgtacaaggtggtaagggtatattggaatgt 207  Q
    |||||||||||||| |||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47225554 cattatcttgtctcgtagggttcatttttttaaatggttgtaaagcatggtggaaattttaggtttagttgtacaaggtggtaagggtatattggaatgt 47225653  T
208 cttga 212  Q
    |||||    
47225654 cttga 47225658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 116111 times since January 2019
Visitors: 1394