View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_high_2 (Length: 424)

Name: NF4435_high_2
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435_high_2
NF4435_high_2
[»] chr5 (7 HSPs)
chr5 (1-405)||(11903109-11903513)
chr5 (57-264)||(11730745-11730955)
chr5 (30-214)||(11730274-11730461)
chr5 (135-233)||(11859136-11859234)
chr5 (125-233)||(12037924-12038032)
chr5 (135-228)||(11826968-11827061)
chr5 (48-103)||(11859049-11859104)


Alignment Details
Target: chr5 (Bit Score: 405; Significance: 0; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 1 - 405
Target Start/End: Complemental strand, 11903513 - 11903109
Alignment:
1 atagtaacatgaagaatgtcaaaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11903513 atagtaacatgaagaatgtcaaaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaa 11903414  T
101 caaccctgctgatgatttcgttcctgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11903413 caaccctgctgatgatttcgttcctgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtc 11903314  T
201 aaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctttgatgtggaatacattgctaacttagctatgaccacagtcattgatg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11903313 aaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctttgatgtggaatacattgctaacttagctatgaccacagtcattgatg 11903214  T
301 gaagtgtacgccgcctacttgtgctcgatgatttgcgaattgagattaagcatgatcttgaaaagttgcaaaagaaattaactgaatctggcggtaccag 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11903213 gaagtgtacgccgcctacttgtgctcgatgatttgcgaattgagattaagcatgatcttgaaaagttgcaaaagaaattaactgaatctggcggtaccag 11903114  T
401 ttggg 405  Q
    |||||    
11903113 ttggg 11903109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 57 - 264
Target Start/End: Original strand, 11730745 - 11730955
Alignment:
57 gaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgatttc---gttcctgttattgtcattgttggtgttcctggaa 153  Q
    ||||| || ||||| ||| || ||||||||||||| || ||||||||  || ||||||||||    |||  |||| ||||||||||||||||||| ||||    
11730745 gaaaaagagaagaaagagcttgtagatcaactacttaacttgaacaattctactgatgattttcatgttggtgtttttgtcattgttggtgttccgggaa 11730844  T
154 ttgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctt 253  Q
    | ||||| |||||||||||| | ||||||||||| ||||| |||||||||||  |||||||  |  ||||||||||||||  |  ||| || || |||||    
11730845 tagggaagacaaaacttgcacggcttgtttgcgaggatgagcaagtcaaagcaaattttgggctacaaccaatttggatcgatcttctacacgagacctt 11730944  T
254 tgatgtggaat 264  Q
    |||||||||||    
11730945 tgatgtggaat 11730955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 11730274 - 11730461
Alignment:
30 tttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgatttc---gttcctg 126  Q
    ||||||||| ||||  ||||||| |||||| |||| ||||| ||||||||||||| |||||| |||| || |||  || |||||| |||    |||  ||    
11730274 tttgagaaagttactgtggttggaagagaatatgagaagaaagagattatagatcgactacttaagtggatcaaatctactgatgcttttcatgttggtg 11730373  T
127 ttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttgg 214  Q
    || ||||||||||||||||| | ||||| || || |||||||||||| ||||||||||| | ||||| |||||||||||  |||||||    
11730374 tttttgtcattgttggtgtttcaggaataggaaagacaaaacttgcacgtcttgtttgcaaggatgagcaagtcaaagcaaattttgg 11730461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 135 - 233
Target Start/End: Original strand, 11859136 - 11859234
Alignment:
135 attgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaatttggatc 233  Q
    ||||||||||||||||||||||| ||||||||||||||  |||| ||||| |||||||| ||||||||||    || ||||||| || |||||||||||    
11859136 attgttggtgttcctggaattggcaaaacaaaacttgctcgtctcgtttgtgaagatgagcaagtcaaagggagttctggtttccaagcaatttggatc 11859234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 125 - 233
Target Start/End: Original strand, 12037924 - 12038032
Alignment:
125 tgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaacca 224  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||   ||| ||||| || ||||| |||||| ||    ||||||| ||  |||||    
12037924 tgttattgttattgttggtgttcctggaattggcaaaacaaaacttgctcatctcgtttgtgaggatgagcaagtcgaaatgaattttgggttacaacca 12038023  T
225 atttggatc 233  Q
    |||||||||    
12038024 atttggatc 12038032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 135 - 228
Target Start/End: Original strand, 11826968 - 11827061
Alignment:
135 attgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaattt 228  Q
    |||||||||||| |||||||||||||||||||||||||   ||| ||||| || || || |||||||||||  ||||||  ||||||| |||||    
11826968 attgttggtgttactggaattgggaaaacaaaacttgctcatctcgtttgtgaggacgagcaagtcaaagcgaattttgaattcgaacaaattt 11827061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 103
Target Start/End: Original strand, 11859049 - 11859104
Alignment:
48 gttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaa 103  Q
    |||||||||||||  || |||||||||||||||||| |||| |||||| |||||||    
11859049 gttggcagagaaagagagaagaaggagattatagataaactgctgaagatgaacaa 11859104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109776 times since January 2019
Visitors: 1349