View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_high_6 (Length: 235)

Name: NF4435_high_6
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435_high_6
[»] chr2 (1 HSPs)
chr2 (1-221)||(3015659-3015876)

Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3015876 - 3015659
1 aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcatcaacaaacaaattcccattttctgctgctagctcatgcagcatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3015876 aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcaccaacaaacaaattcccattttctgctgctagctcatgcagcatg 3015777  T
101 ttccttgacatatcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgatgacgacgacgactttgaccttttaattctac 200  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||||||    
3015776 ttccttgacatttcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgat---gatgacgactttgaccttttaattctac 3015680  T
201 agaaacaagtgaggtagaatt 221  Q
3015679 agaaacaagtgaggtagaatt 3015659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 217339 times since January 2019
Visitors: 2908