View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_low_3 (Length: 424)

Name: NF4435_low_3
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435_low_3
[»] chr5 (7 HSPs)
chr5 (1-405)||(11903109-11903513)
chr5 (57-264)||(11730745-11730955)
chr5 (30-214)||(11730274-11730461)
chr5 (135-233)||(11859136-11859234)
chr5 (125-233)||(12037924-12038032)
chr5 (135-228)||(11826968-11827061)
chr5 (48-103)||(11859049-11859104)

Alignment Details
Target: chr5 (Bit Score: 405; Significance: 0; HSPs: 7)
Name: chr5

Target: chr5; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 1 - 405
Target Start/End: Complemental strand, 11903513 - 11903109
1 atagtaacatgaagaatgtcaaaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaa 100  Q
11903513 atagtaacatgaagaatgtcaaaagaaattttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaa 11903414  T
101 caaccctgctgatgatttcgttcctgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtc 200  Q
11903413 caaccctgctgatgatttcgttcctgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtc 11903314  T
201 aaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctttgatgtggaatacattgctaacttagctatgaccacagtcattgatg 300  Q
11903313 aaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctttgatgtggaatacattgctaacttagctatgaccacagtcattgatg 11903214  T
301 gaagtgtacgccgcctacttgtgctcgatgatttgcgaattgagattaagcatgatcttgaaaagttgcaaaagaaattaactgaatctggcggtaccag 400  Q
11903213 gaagtgtacgccgcctacttgtgctcgatgatttgcgaattgagattaagcatgatcttgaaaagttgcaaaagaaattaactgaatctggcggtaccag 11903114  T
401 ttggg 405  Q
11903113 ttggg 11903109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 57 - 264
Target Start/End: Original strand, 11730745 - 11730955
57 gaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgatttc---gttcctgttattgtcattgttggtgttcctggaa 153  Q
    ||||| || ||||| ||| || ||||||||||||| || ||||||||  || ||||||||||    |||  |||| ||||||||||||||||||| ||||    
11730745 gaaaaagagaagaaagagcttgtagatcaactacttaacttgaacaattctactgatgattttcatgttggtgtttttgtcattgttggtgttccgggaa 11730844  T
154 ttgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaatttggatccgttctctccatgaaacctt 253  Q
    | ||||| |||||||||||| | ||||||||||| ||||| |||||||||||  |||||||  |  ||||||||||||||  |  ||| || || |||||    
11730845 tagggaagacaaaacttgcacggcttgtttgcgaggatgagcaagtcaaagcaaattttgggctacaaccaatttggatcgatcttctacacgagacctt 11730944  T
254 tgatgtggaat 264  Q
11730945 tgatgtggaat 11730955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 11730274 - 11730461
30 tttgagaaaattaccatggttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaaccctgctgatgatttc---gttcctg 126  Q
    ||||||||| ||||  ||||||| |||||| |||| ||||| ||||||||||||| |||||| |||| || |||  || |||||| |||    |||  ||    
11730274 tttgagaaagttactgtggttggaagagaatatgagaagaaagagattatagatcgactacttaagtggatcaaatctactgatgcttttcatgttggtg 11730373  T
127 ttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttgg 214  Q
    || ||||||||||||||||| | ||||| || || |||||||||||| ||||||||||| | ||||| |||||||||||  |||||||    
11730374 tttttgtcattgttggtgtttcaggaataggaaagacaaaacttgcacgtcttgtttgcaaggatgagcaagtcaaagcaaattttgg 11730461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 135 - 233
Target Start/End: Original strand, 11859136 - 11859234
135 attgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaatttggatc 233  Q
    ||||||||||||||||||||||| ||||||||||||||  |||| ||||| |||||||| ||||||||||    || ||||||| || |||||||||||    
11859136 attgttggtgttcctggaattggcaaaacaaaacttgctcgtctcgtttgtgaagatgagcaagtcaaagggagttctggtttccaagcaatttggatc 11859234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 125 - 233
Target Start/End: Original strand, 12037924 - 12038032
125 tgttattgtcattgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaacca 224  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||   ||| ||||| || ||||| |||||| ||    ||||||| ||  |||||    
12037924 tgttattgttattgttggtgttcctggaattggcaaaacaaaacttgctcatctcgtttgtgaggatgagcaagtcgaaatgaattttgggttacaacca 12038023  T
225 atttggatc 233  Q
12038024 atttggatc 12038032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 135 - 228
Target Start/End: Original strand, 11826968 - 11827061
135 attgttggtgttcctggaattgggaaaacaaaacttgcaagtcttgtttgcgaagatgaacaagtcaaagctcattttggtttcgaaccaattt 228  Q
    |||||||||||| |||||||||||||||||||||||||   ||| ||||| || || || |||||||||||  ||||||  ||||||| |||||    
11826968 attgttggtgttactggaattgggaaaacaaaacttgctcatctcgtttgtgaggacgagcaagtcaaagcgaattttgaattcgaacaaattt 11827061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 103
Target Start/End: Original strand, 11859049 - 11859104
48 gttggcagagaaaatgaaaagaaggagattatagatcaactactgaagttgaacaa 103  Q
    |||||||||||||  || |||||||||||||||||| |||| |||||| |||||||    
11859049 gttggcagagaaagagagaagaaggagattatagataaactgctgaagatgaacaa 11859104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111548 times since January 2019
Visitors: 1375