View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_low_4 (Length: 343)

Name: NF4435_low_4
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435_low_4
NF4435_low_4
[»] chr2 (4 HSPs)
chr2 (10-327)||(37960239-37960556)
chr2 (144-327)||(37954430-37954613)
chr2 (76-303)||(37907552-37907779)
chr2 (10-327)||(37915639-37915956)
[»] chr8 (1 HSPs)
chr8 (16-327)||(3783787-3784107)


Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 10 - 327
Target Start/End: Complemental strand, 37960556 - 37960239
Alignment:
10 ttatactgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat 109  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
37960556 ttataccgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtatcgaaaagaagataagacatttaaagagtcat 37960457  T
110 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgttt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
37960456 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctgtaactgtggttgctggttcaccgaaattggctgttt 37960357  T
210 atgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggagg 309  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
37960356 atgagacagattttgggtgggggaagcctaagaaatctgatgctgttcatcttgattcgtccggttcgatttctctttctgattgtagagacggcggagg 37960257  T
310 tggaattgaagttggttt 327  Q
    ||||||||||||||||||    
37960256 tggaattgaagttggttt 37960239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 144 - 327
Target Start/End: Complemental strand, 37954613 - 37954430
Alignment:
144 atagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgtttatgatacagattttgggtgggggaagcctaagaa 243  Q
    ||||||||||||||||||||||||||||| | | |||| |||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||    
37954613 atagggaaatgtcaaaacctggtaagtctgttaatgtgattgctggttcaccgaatttggctgtttatgagacagattttggatgggggaagcctaagaa 37954514  T
244 atctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggaggtggaattgaagttggttt 327  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||| | ||||||||    
37954513 atctgatgcagttcatcttgattcatccggttcgatttctctttctgattgtagaggtggtggaggtggaattaaggttggttt 37954430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 76 - 303
Target Start/End: Original strand, 37907552 - 37907779
Alignment:
76 tattgaaaagaagataagacattttaagagtcatgctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtcttta 175  Q
    |||| |||||||||||||| ||||||||||| |||||||||||| ||||||||| |||||  ||||||||| |||| | | |||||||||||| || ||     
37907552 tatttaaaagaagataagagattttaagagtgatgctttgttagaagctgaaacgttgatacctgattatatggaattattaaaacctggtaactcattt 37907651  T
176 actgtggttgctggttcaccgaaattggctgtttatgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggtt 275  Q
       ||||||||||| ||||| ||| | | ||||| ||| || |||||||||||||| || || ||||||||||||||||| ||| ||||||||| | |||    
37907652 gtagtggttgctgggtcacctaaacttgatgtttgtgagactgattttgggtggggaaaaccaaagaaatctgatgcagtgcatattgattcgttccgtt 37907751  T
276 cgatttctctttctgattgtagagatgg 303  Q
    ||||||||||||||||||||||||||||    
37907752 cgatttctctttctgattgtagagatgg 37907779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 10 - 327
Target Start/End: Original strand, 37915639 - 37915956
Alignment:
10 ttatactgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat 109  Q
    ||||||||| | |||||| || | ||||||| |||||||| |||| ||| ||  |||  ||| || |||||||  |||||||||| |||| |||||| ||    
37915639 ttatactgtagttgtaaataggggtgagttagttggaaaagatggtattcttgtggcggcaaatgctattgaacggaagataagagatttcaagagtgat 37915738  T
110 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgttt 209  Q
    || ||||| |||| |||||| |||||| ||||||||||||||||   |||||| ||||| ||| | |   ||||| |||| || || ||| | | |||||    
37915739 gccttgttgggagttgaaacgttgatgcctgattatagggaaataataaaaccaggtaactctgttaaaatggtttctgggtcgcctaaacttgatgttt 37915838  T
210 atgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggagg 309  Q
    |||| || |||||||||||||| || || |||||||| |||| ||| ||| ||||||||||| |||||||||||||||||||||||||||||||  ||||    
37915839 atgagactgattttgggtggggaaaaccaaagaaatccgatgtagtgcatattgattcgtccagttcgatttctctttctgattgtagagatggtcgagg 37915938  T
310 tggaattgaagttggttt 327  Q
    ||||||||| ||||||||    
37915939 tggaattgaggttggttt 37915956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 327
Target Start/End: Original strand, 3783787 - 3784107
Alignment:
16 tgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat---gct 112  Q
    ||||| ||||||||| | ||||||| |||||| ||||||||||||| ||||| ||| |||||| |||| |||||||||| |||| |||||| ||   |||    
3783787 tgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatggtatcgaaaggaagataagagatttcaagagtgataatgct 3783886  T
113 ttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgtttatg 212  Q
    ||||||||  || ||   | ||  |||||| |||| ||| | |||||||||||||||||| |    |   ||||||| ||||| ||||| | ||||||||    
3783887 ttgttaggtcctaaatggtggacttctgatcatagtgaattatcaaaacctggtaagtctgttgtaggaattgctggctcacctaaatttgatgtttatg 3783986  T
213 atacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcg------atttctctttctgattgtagagatggcgg 306  Q
    | || || || ||||||||||||||||| |||||||||||||||||||||||||||||   ||||      |||||||||||||||||||||||||| ||    
3783987 agactgacttcgggtgggggaagcctaaaaaatctgatgcagttcatcttgattcgtcgtcttcgatttctatttctctttctgattgtagagatggtgg 3784086  T
307 aggtggaattgaagttggttt 327  Q
    |||||||||| | ||||||||    
3784087 aggtggaattcaggttggttt 3784107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 116056 times since January 2019
Visitors: 1394