View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_low_4 (Length: 343)

Name: NF4435_low_4
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4435_low_4
[»] chr2 (4 HSPs)
chr2 (10-327)||(37960239-37960556)
chr2 (144-327)||(37954430-37954613)
chr2 (76-303)||(37907552-37907779)
chr2 (10-327)||(37915639-37915956)
[»] chr8 (1 HSPs)
chr8 (16-327)||(3783787-3784107)

Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 4)
Name: chr2

Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 10 - 327
Target Start/End: Complemental strand, 37960556 - 37960239
10 ttatactgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat 109  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
37960556 ttataccgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtatcgaaaagaagataagacatttaaagagtcat 37960457  T
110 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgttt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
37960456 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctgtaactgtggttgctggttcaccgaaattggctgttt 37960357  T
210 atgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggagg 309  Q
    |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
37960356 atgagacagattttgggtgggggaagcctaagaaatctgatgctgttcatcttgattcgtccggttcgatttctctttctgattgtagagacggcggagg 37960257  T
310 tggaattgaagttggttt 327  Q
37960256 tggaattgaagttggttt 37960239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 144 - 327
Target Start/End: Complemental strand, 37954613 - 37954430
144 atagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgtttatgatacagattttgggtgggggaagcctaagaa 243  Q
    ||||||||||||||||||||||||||||| | | |||| |||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||    
37954613 atagggaaatgtcaaaacctggtaagtctgttaatgtgattgctggttcaccgaatttggctgtttatgagacagattttggatgggggaagcctaagaa 37954514  T
244 atctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggaggtggaattgaagttggttt 327  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||| | ||||||||    
37954513 atctgatgcagttcatcttgattcatccggttcgatttctctttctgattgtagaggtggtggaggtggaattaaggttggttt 37954430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 76 - 303
Target Start/End: Original strand, 37907552 - 37907779
76 tattgaaaagaagataagacattttaagagtcatgctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtcttta 175  Q
    |||| |||||||||||||| ||||||||||| |||||||||||| ||||||||| |||||  ||||||||| |||| | | |||||||||||| || ||     
37907552 tatttaaaagaagataagagattttaagagtgatgctttgttagaagctgaaacgttgatacctgattatatggaattattaaaacctggtaactcattt 37907651  T
176 actgtggttgctggttcaccgaaattggctgtttatgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggtt 275  Q
       ||||||||||| ||||| ||| | | ||||| ||| || |||||||||||||| || || ||||||||||||||||| ||| ||||||||| | |||    
37907652 gtagtggttgctgggtcacctaaacttgatgtttgtgagactgattttgggtggggaaaaccaaagaaatctgatgcagtgcatattgattcgttccgtt 37907751  T
276 cgatttctctttctgattgtagagatgg 303  Q
37907752 cgatttctctttctgattgtagagatgg 37907779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 10 - 327
Target Start/End: Original strand, 37915639 - 37915956
10 ttatactgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat 109  Q
    ||||||||| | |||||| || | ||||||| |||||||| |||| ||| ||  |||  ||| || |||||||  |||||||||| |||| |||||| ||    
37915639 ttatactgtagttgtaaataggggtgagttagttggaaaagatggtattcttgtggcggcaaatgctattgaacggaagataagagatttcaagagtgat 37915738  T
110 gctttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgttt 209  Q
    || ||||| |||| |||||| |||||| ||||||||||||||||   |||||| ||||| ||| | |   ||||| |||| || || ||| | | |||||    
37915739 gccttgttgggagttgaaacgttgatgcctgattatagggaaataataaaaccaggtaactctgttaaaatggtttctgggtcgcctaaacttgatgttt 37915838  T
210 atgatacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcgatttctctttctgattgtagagatggcggagg 309  Q
    |||| || |||||||||||||| || || |||||||| |||| ||| ||| ||||||||||| |||||||||||||||||||||||||||||||  ||||    
37915839 atgagactgattttgggtggggaaaaccaaagaaatccgatgtagtgcatattgattcgtccagttcgatttctctttctgattgtagagatggtcgagg 37915938  T
310 tggaattgaagttggttt 327  Q
    ||||||||| ||||||||    
37915939 tggaattgaggttggttt 37915956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 327
Target Start/End: Original strand, 3783787 - 3784107
16 tgtggctgtaaagagagatgagttaattggaaaaaatgggattgtttcggcttcaattggtattgaaaagaagataagacattttaagagtcat---gct 112  Q
    ||||| ||||||||| | ||||||| |||||| ||||||||||||| ||||| ||| |||||| |||| |||||||||| |||| |||||| ||   |||    
3783787 tgtggttgtaaagagggctgagttagttggaacaaatgggattgttgcggctgcaaatggtatcgaaaggaagataagagatttcaagagtgataatgct 3783886  T
113 ttgttaggagctgaaacattgatgtctgattatagggaaatgtcaaaacctggtaagtctttaactgtggttgctggttcaccgaaattggctgtttatg 212  Q
    ||||||||  || ||   | ||  |||||| |||| ||| | |||||||||||||||||| |    |   ||||||| ||||| ||||| | ||||||||    
3783887 ttgttaggtcctaaatggtggacttctgatcatagtgaattatcaaaacctggtaagtctgttgtaggaattgctggctcacctaaatttgatgtttatg 3783986  T
213 atacagattttgggtgggggaagcctaagaaatctgatgcagttcatcttgattcgtccggttcg------atttctctttctgattgtagagatggcgg 306  Q
    | || || || ||||||||||||||||| |||||||||||||||||||||||||||||   ||||      |||||||||||||||||||||||||| ||    
3783987 agactgacttcgggtgggggaagcctaaaaaatctgatgcagttcatcttgattcgtcgtcttcgatttctatttctctttctgattgtagagatggtgg 3784086  T
307 aggtggaattgaagttggttt 327  Q
    |||||||||| | ||||||||    
3784087 aggtggaattcaggttggttt 3784107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191961 times since January 2019
Visitors: 2831