View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4435_low_9 (Length: 235)

Name: NF4435_low_9
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4435_low_9
NF4435_low_9
[»] chr2 (1 HSPs)
chr2 (1-221)||(3015659-3015876)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3015876 - 3015659
Alignment:
1 aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcatcaacaaacaaattcccattttctgctgctagctcatgcagcatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3015876 aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcaccaacaaacaaattcccattttctgctgctagctcatgcagcatg 3015777  T
101 ttccttgacatatcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgatgacgacgacgactttgaccttttaattctac 200  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||||||    
3015776 ttccttgacatttcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgat---gatgacgactttgaccttttaattctac 3015680  T
201 agaaacaagtgaggtagaatt 221  Q
    |||||||||||||||||||||    
3015679 agaaacaagtgaggtagaatt 3015659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125111 times since January 2019
Visitors: 1445