View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555-Insertion-4 (Length: 222)

Name: NF4555-Insertion-4
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4555-Insertion-4
NF4555-Insertion-4
[»] chr4 (21 HSPs)
chr4 (8-221)||(3815710-3815923)
chr4 (8-210)||(3808147-3808349)
chr4 (8-130)||(3935197-3935319)
chr4 (8-130)||(3985187-3985309)
chr4 (140-221)||(3985036-3985117)
chr4 (8-128)||(3921849-3921969)
chr4 (140-221)||(4023112-4023193)
chr4 (140-207)||(3922044-3922111)
chr4 (8-124)||(3936835-3936950)
chr4 (140-221)||(3957503-3957584)
chr4 (140-203)||(4000211-4000274)
chr4 (140-208)||(3935392-3935460)
chr4 (8-128)||(4023265-4023385)
chr4 (140-210)||(3799922-3799992)
chr4 (140-210)||(4216869-4216939)
chr4 (69-130)||(3957366-3957427)
chr4 (70-130)||(4008105-4008165)
chr4 (16-130)||(4000347-4000461)
chr4 (137-210)||(3998960-3999033)
chr4 (70-130)||(3999100-3999160)
chr4 (176-221)||(4000157-4000202)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 21)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 3815923 - 3815710
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| ||||||||||  | ||||||||| |||||||||||||| ||||||||||||||    
3815923 aacagttgctgaacaattcaaggaaaacaagaaaagtgttgagttctggaattgcgagaacttggatgaaagttctctcataaatgttgggttgaatgtt 3815824  T
108 caaatcaatttaatgaagtttgctaacgctggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    ||||||||||||||||||| |||||||  |||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
3815823 caaatcaatttaatgaagtatgctaactttggttctgatgaagcaatgtatgtgtatcctggaagtagtattccagagtggttggagtacaagacaacaa 3815724  T
208 aggttgatatgatt 221  Q
    ||| ||||||||||    
3815723 aggatgatatgatt 3815710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 3808349 - 3808147
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| || ||||| |  | ||||||||| |||||||||||||| ||||||||||||||    
3808349 aacagttgctgaacaattcaaggaaaacaagaaaagtgttgagttctggcattgcaagaacttggatgaaagttctctcataaatgttgggttgaatgtt 3808250  T
108 caaatcaatttaatgaagtttgctaacgctggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    ||||||||||||||||||| |||||||  |||||||||| ||||| ||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
3808249 caaatcaatttaatgaagtatgctaactttggttctgatgaagcaatgtatgtgtatcctggaagtaatgttccagagtggtttgagtacaagacaacaa 3808150  T
208 agg 210  Q
    |||    
3808149 agg 3808147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 3935197 - 3935319
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||    | |||||||| |||||||| |||||||||||||||||| |     
3935197 aacagttgctgaacaattcaaggaaaacaagaaagaagttaagttctggaattgcttgaacttggatgagcgttctctgataaatattgggttgaatctg 3935296  T
108 caaatcaatttaatgaagtttgc 130  Q
    ||||||||||| |||||||||||    
3935297 caaatcaatttgatgaagtttgc 3935319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 3985309 - 3985187
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    |||||||||||||||||| |||||||| ||||||    |||| ||| ||||||||  | |||||||||||||||||||||||||||||||||||||| ||    
3985309 aacagttgctgaacaattaaaggaaaacaagaaaaggattgagttctggaattgcttcaaattggatgaacgttctctcataaatattgggttgaatctt 3985210  T
108 caaatcaatttaatgaagtttgc 130  Q
    ||||||||||| ||| |||||||    
3985209 caaatcaatttgatggagtttgc 3985187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 3985117 - 3985036
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
3985117 ttcttatcaagcagtgtatgtatatcctggaagtagtgttccagagtggttggagtacaagacaacaaagaatgatatgatt 3985036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 8 - 128
Target Start/End: Original strand, 3921849 - 3921969
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| ||||||||  | | |||||||||| |||||| |||||||||||||||||| |     
3921849 aacagttgctgaacaattcaaggaaaacaagaaaagggttgagttctggaattgcttcaacttggatgaactttctctgataaatattgggttgaatctg 3921948  T
108 caaatcaatttaatgaagttt 128  Q
    ||||||||||| |||||||||    
3921949 caaatcaatttgatgaagttt 3921969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 4023193 - 4023112
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||    
4023193 ttcttatcaagcagtgtatgtttatcctggaagtagtattccagagtggttggagtacaagacaacaaaggatgacatgatt 4023112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 140 - 207
Target Start/End: Original strand, 3922044 - 3922111
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    |||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||    
3922044 ttcttatcaagcagtgtatgtgtatcctggaagtagtgttccaaagtggttggagtacaagacaacaa 3922111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 8 - 124
Target Start/End: Original strand, 3936835 - 3936950
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    |||||||||||||||||| |||||||| || ||||| ||||| ||| ||||||||    | |||  | || |||||||||||||||||||||||||||||    
3936835 aacagttgctgaacaattaaaggaaaacaaaaaaga-gttgagttctggaattgctggaacttgattaaatgttctctcataaatattgggttgaatgtt 3936933  T
108 caaatcaatttaatgaa 124  Q
    |||||||||||||||||    
3936934 caaatcaatttaatgaa 3936950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 3957503 - 3957584
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||  |||||| |||| || ||| ||||||||||    
3957503 ttcttatcaagcagtgtatttgtatcctggaagtagtgttccagagtggttcaagtacaggacagcacaggatgatatgatt 3957584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 140 - 203
Target Start/End: Complemental strand, 4000274 - 4000211
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagaca 203  Q
    |||| |||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||    
4000274 ttcttatcaagcattgtatgtatatcctggaagtagtgttccagagtggttggagtacaagaca 4000211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 140 - 208
Target Start/End: Original strand, 3935392 - 3935460
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaa 208  Q
    |||| |||||||| ||||| ||||| ||||||||||||||||||| ||||| |||||||||||||||||    
3935392 ttcttatcaagcattgtatgtgtattctggaagtagtgttccagattggtttgagtacaagacaacaaa 3935460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 4023385 - 4023265
Alignment:
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||| ||||||||||||||||||| ||||||    |||| ||| ||||||||    | |||||||||| ||||||||||||||||||||||||| |     
4023385 aacagtttctgaacaattcaaggaaaacaagaaaaggattgagttctggaattgctggaacttggatgaacattctctcataaatattgggttgaatctg 4023286  T
108 caaatcaatttaatgaagttt 128  Q
    ||||| ||||| || ||||||    
4023285 caaatgaatttgataaagttt 4023265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 3799992 - 3799922
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    |||| ||||||||  |||| | ||| ||||||||||||||||| |||||||||||||||||||||||||||    
3799992 ttcttatcaagcaccgtatgtttattctggaagtagtgttccatagtggttggagtacaagacaacaaagg 3799922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 4216939 - 4216869
Alignment:
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    |||| ||||||||  |||| | ||| ||||||||||||||||| |||||||||||||||||||||||||||    
4216939 ttcttatcaagcaccgtatgtttattctggaagtagtgttccatagtggttggagtacaagacaacaaagg 4216869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 69 - 130
Target Start/End: Original strand, 3957366 - 3957427
Alignment:
69 ttggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||||||| | |||||||||||||||||||||||||| || |||||||| |||||||||||    
3957366 ttggatgaatgctctctcataaatattgggttgaatgtgcagatcaatttgatgaagtttgc 3957427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 4008165 - 4008105
Alignment:
70 tggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||| |||||||||| |||||||||| ||||||| ||||||||||| |||||||||||||    
4008165 tggataaacgttctcttataaatattgagttgaatattcaaatcaatataatgaagtttgc 4008105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 4000461 - 4000347
Alignment:
16 ctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgttcaaatcaa 115  Q
    ||||||||||||||||||| ||||||    |||| ||| ||||||||  | | |||||||||| ||||||| ||||||||||||| ||| |  |||||||    
4000461 ctgaacaattcaaggaaaacaagaaaaggattgagttctggaattgcttcaacttggatgaacattctctcgtaaatattgggttcaatatgaaaatcaa 4000362  T
116 tttaatgaagtttgc 130  Q
    | |||| ||||||||    
4000361 tctaatcaagtttgc 4000347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 3999033 - 3998960
Alignment:
137 tggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    ||||||| |||||||| ||||| | ||||| ||||| |||||| |||||| |||||||||||| ||||||||||    
3999033 tggttcttatcaagcattgtatgtttatccaggaagcagtgtttcagagtcgttggagtacaaaacaacaaagg 3998960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 3999160 - 3999100
Alignment:
70 tggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||| ||||||||| ||||||| ||| ||||||| ||||||||||| |||| ||||||||    
3999160 tggataaacgttctcacataaatgttgagttgaatattcaaatcaatataataaagtttgc 3999100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 4000202 - 4000157
Alignment:
176 tgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    ||||| ||||||||||||||||||||||||| ||| ||| ||||||    
4000202 tgttcgagagtggttggagtacaagacaacagaggatgacatgatt 4000157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175367 times since January 2019
Visitors: 2677