View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555-Insertion-4 (Length: 222)

Name: NF4555-Insertion-4
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4555-Insertion-4
[»] chr4 (21 HSPs)
chr4 (8-221)||(3815710-3815923)
chr4 (8-210)||(3808147-3808349)
chr4 (8-130)||(3935197-3935319)
chr4 (8-130)||(3985187-3985309)
chr4 (140-221)||(3985036-3985117)
chr4 (8-128)||(3921849-3921969)
chr4 (140-221)||(4023112-4023193)
chr4 (140-207)||(3922044-3922111)
chr4 (8-124)||(3936835-3936950)
chr4 (140-221)||(3957503-3957584)
chr4 (140-203)||(4000211-4000274)
chr4 (140-208)||(3935392-3935460)
chr4 (8-128)||(4023265-4023385)
chr4 (140-210)||(3799922-3799992)
chr4 (140-210)||(4216869-4216939)
chr4 (69-130)||(3957366-3957427)
chr4 (70-130)||(4008105-4008165)
chr4 (16-130)||(4000347-4000461)
chr4 (137-210)||(3998960-3999033)
chr4 (70-130)||(3999100-3999160)
chr4 (176-221)||(4000157-4000202)

Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 21)
Name: chr4

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 3815923 - 3815710
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| ||||||||||  | ||||||||| |||||||||||||| ||||||||||||||    
3815923 aacagttgctgaacaattcaaggaaaacaagaaaagtgttgagttctggaattgcgagaacttggatgaaagttctctcataaatgttgggttgaatgtt 3815824  T
108 caaatcaatttaatgaagtttgctaacgctggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    ||||||||||||||||||| |||||||  |||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
3815823 caaatcaatttaatgaagtatgctaactttggttctgatgaagcaatgtatgtgtatcctggaagtagtattccagagtggttggagtacaagacaacaa 3815724  T
208 aggttgatatgatt 221  Q
    ||| ||||||||||    
3815723 aggatgatatgatt 3815710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 3808349 - 3808147
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| || ||||| |  | ||||||||| |||||||||||||| ||||||||||||||    
3808349 aacagttgctgaacaattcaaggaaaacaagaaaagtgttgagttctggcattgcaagaacttggatgaaagttctctcataaatgttgggttgaatgtt 3808250  T
108 caaatcaatttaatgaagtttgctaacgctggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    ||||||||||||||||||| |||||||  |||||||||| ||||| ||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
3808249 caaatcaatttaatgaagtatgctaactttggttctgatgaagcaatgtatgtgtatcctggaagtaatgttccagagtggtttgagtacaagacaacaa 3808150  T
208 agg 210  Q
3808149 agg 3808147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 3935197 - 3935319
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||    | |||||||| |||||||| |||||||||||||||||| |     
3935197 aacagttgctgaacaattcaaggaaaacaagaaagaagttaagttctggaattgcttgaacttggatgagcgttctctgataaatattgggttgaatctg 3935296  T
108 caaatcaatttaatgaagtttgc 130  Q
    ||||||||||| |||||||||||    
3935297 caaatcaatttgatgaagtttgc 3935319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 3985309 - 3985187
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    |||||||||||||||||| |||||||| ||||||    |||| ||| ||||||||  | |||||||||||||||||||||||||||||||||||||| ||    
3985309 aacagttgctgaacaattaaaggaaaacaagaaaaggattgagttctggaattgcttcaaattggatgaacgttctctcataaatattgggttgaatctt 3985210  T
108 caaatcaatttaatgaagtttgc 130  Q
    ||||||||||| ||| |||||||    
3985209 caaatcaatttgatggagtttgc 3985187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 3985117 - 3985036
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
3985117 ttcttatcaagcagtgtatgtatatcctggaagtagtgttccagagtggttggagtacaagacaacaaagaatgatatgatt 3985036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 8 - 128
Target Start/End: Original strand, 3921849 - 3921969
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||||||||||||||||||||||| ||||||   ||||| ||| ||||||||  | | |||||||||| |||||| |||||||||||||||||| |     
3921849 aacagttgctgaacaattcaaggaaaacaagaaaagggttgagttctggaattgcttcaacttggatgaactttctctgataaatattgggttgaatctg 3921948  T
108 caaatcaatttaatgaagttt 128  Q
    ||||||||||| |||||||||    
3921949 caaatcaatttgatgaagttt 3921969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 4023193 - 4023112
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||    
4023193 ttcttatcaagcagtgtatgtttatcctggaagtagtattccagagtggttggagtacaagacaacaaaggatgacatgatt 4023112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 140 - 207
Target Start/End: Original strand, 3922044 - 3922111
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaa 207  Q
    |||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||    
3922044 ttcttatcaagcagtgtatgtgtatcctggaagtagtgttccaaagtggttggagtacaagacaacaa 3922111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 8 - 124
Target Start/End: Original strand, 3936835 - 3936950
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    |||||||||||||||||| |||||||| || ||||| ||||| ||| ||||||||    | |||  | || |||||||||||||||||||||||||||||    
3936835 aacagttgctgaacaattaaaggaaaacaaaaaaga-gttgagttctggaattgctggaacttgattaaatgttctctcataaatattgggttgaatgtt 3936933  T
108 caaatcaatttaatgaa 124  Q
3936934 caaatcaatttaatgaa 3936950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 3957503 - 3957584
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||  |||||| |||| || ||| ||||||||||    
3957503 ttcttatcaagcagtgtatttgtatcctggaagtagtgttccagagtggttcaagtacaggacagcacaggatgatatgatt 3957584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 140 - 203
Target Start/End: Complemental strand, 4000274 - 4000211
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagaca 203  Q
    |||| |||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||    
4000274 ttcttatcaagcattgtatgtatatcctggaagtagtgttccagagtggttggagtacaagaca 4000211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 140 - 208
Target Start/End: Original strand, 3935392 - 3935460
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaa 208  Q
    |||| |||||||| ||||| ||||| ||||||||||||||||||| ||||| |||||||||||||||||    
3935392 ttcttatcaagcattgtatgtgtattctggaagtagtgttccagattggtttgagtacaagacaacaaa 3935460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 4023385 - 4023265
8 aacagttgctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgtt 107  Q
    ||||||| ||||||||||||||||||| ||||||    |||| ||| ||||||||    | |||||||||| ||||||||||||||||||||||||| |     
4023385 aacagtttctgaacaattcaaggaaaacaagaaaaggattgagttctggaattgctggaacttggatgaacattctctcataaatattgggttgaatctg 4023286  T
108 caaatcaatttaatgaagttt 128  Q
    ||||| ||||| || ||||||    
4023285 caaatgaatttgataaagttt 4023265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 3799992 - 3799922
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    |||| ||||||||  |||| | ||| ||||||||||||||||| |||||||||||||||||||||||||||    
3799992 ttcttatcaagcaccgtatgtttattctggaagtagtgttccatagtggttggagtacaagacaacaaagg 3799922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 4216939 - 4216869
140 ttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    |||| ||||||||  |||| | ||| ||||||||||||||||| |||||||||||||||||||||||||||    
4216939 ttcttatcaagcaccgtatgtttattctggaagtagtgttccatagtggttggagtacaagacaacaaagg 4216869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 69 - 130
Target Start/End: Original strand, 3957366 - 3957427
69 ttggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||||||| | |||||||||||||||||||||||||| || |||||||| |||||||||||    
3957366 ttggatgaatgctctctcataaatattgggttgaatgtgcagatcaatttgatgaagtttgc 3957427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 4008165 - 4008105
70 tggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||| |||||||||| |||||||||| ||||||| ||||||||||| |||||||||||||    
4008165 tggataaacgttctcttataaatattgagttgaatattcaaatcaatataatgaagtttgc 4008105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 4000461 - 4000347
16 ctgaacaattcaaggaaaataagaaagaagttgatttcaggaattgcgaccaattggatgaacgttctctcataaatattgggttgaatgttcaaatcaa 115  Q
    ||||||||||||||||||| ||||||    |||| ||| ||||||||  | | |||||||||| ||||||| ||||||||||||| ||| |  |||||||    
4000461 ctgaacaattcaaggaaaacaagaaaaggattgagttctggaattgcttcaacttggatgaacattctctcgtaaatattgggttcaatatgaaaatcaa 4000362  T
116 tttaatgaagtttgc 130  Q
    | |||| ||||||||    
4000361 tctaatcaagtttgc 4000347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 3999033 - 3998960
137 tggttctgatcaagcagtgtatatgtatcctggaagtagtgttccagagtggttggagtacaagacaacaaagg 210  Q
    ||||||| |||||||| ||||| | ||||| ||||| |||||| |||||| |||||||||||| ||||||||||    
3999033 tggttcttatcaagcattgtatgtttatccaggaagcagtgtttcagagtcgttggagtacaaaacaacaaagg 3998960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 3999160 - 3999100
70 tggatgaacgttctctcataaatattgggttgaatgttcaaatcaatttaatgaagtttgc 130  Q
    ||||| ||||||||| ||||||| ||| ||||||| ||||||||||| |||| ||||||||    
3999160 tggataaacgttctcacataaatgttgagttgaatattcaaatcaatataataaagtttgc 3999100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 4000202 - 4000157
176 tgttccagagtggttggagtacaagacaacaaaggttgatatgatt 221  Q
    ||||| ||||||||||||||||||||||||| ||| ||| ||||||    
4000202 tgttcgagagtggttggagtacaagacaacagaggatgacatgatt 4000157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 37773 times since January 2019
Visitors: 1597