View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555-Insertion-5 (Length: 134)

Name: NF4555-Insertion-5
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4555-Insertion-5
NF4555-Insertion-5
[»] chr5 (2 HSPs)
chr5 (9-134)||(31324418-31324543)
chr5 (9-134)||(31371849-31371974)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 2e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 9 - 134
Target Start/End: Complemental strand, 31324543 - 31324418
Alignment:
9 ctttgctctgattttttgtaaccaatcatcgccaaaaactgcatccatatcacttggtctatttgtcacttctaaatatttccaattgttcatcatgaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31324543 ctttgctctgattttttgtaaccaatcatcgccaaaaactgcatccatatcacttggtctatttgtcacttctaaatatttccaattgttcatcatgaaa 31324444  T
109 aaatgacgcaaagaagggtccgcata 134  Q
    ||||||||||||||||||||||||||    
31324443 aaatgacgcaaagaagggtccgcata 31324418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 9 - 134
Target Start/End: Complemental strand, 31371974 - 31371849
Alignment:
9 ctttgctctgattttttgtaaccaatcatcgccaaaaactgcatccatatcacttggtctatttgtcacttctaaatatttccaattgttcatcatgaaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||    
31371974 ctttgctctgattttttgtaaccaatcatcgccaaaaactgcatccatattacgtggtctatttgtcacttctaaatatttccaattattcatcatgaaa 31371875  T
109 aaatgacgcaaagaagggtccgcata 134  Q
    ||||||||||||||||||||||||||    
31371874 aaatgacgcaaagaagggtccgcata 31371849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111554 times since January 2019
Visitors: 1375