View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555_high_1 (Length: 513)

Name: NF4555_high_1
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4555_high_1
NF4555_high_1
[»] chr3 (1 HSPs)
chr3 (1-503)||(42113659-42114161)


Alignment Details
Target: chr3 (Bit Score: 487; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 1 - 503
Target Start/End: Original strand, 42113659 - 42114161
Alignment:
1 cattgttttttctcttggattctttgaaccagcttttctcttaacgttgttgtttctcctcaacgcttccatcagaaaaaagacaccaaacgacggttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113659 cattgttttttctcttggattctttgaaccagcttttctcttaacgttgttgtttctcctcaacgcttccatcagaaaaaagacaccaaacgacggttgg 42113758  T
101 gctgtaacctttgtgtttagcacgtgtcttccattaggtattcttcaaggtttacttgtctatttcaatccattggaacatcgtgttccggcgttgttac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113759 gctgtaacctttgtgtttagcacgtgtcttccattaggtattcttcaaggtttacttgtctatttcaatccattggaacatcgtgttccggcgttgttac 42113858  T
201 gacaaacatttgttattctagaagacgacaccgttctctgcgcttacccgttcttaaacagcgttgtgttcgccgcattcgctgctgcatattgtgcatg 300  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
42113859 gacaaacatttgttattctagaagacgacaccgttctctgtgcttacccgttcttaaacagcgttgtgttcgcggcattctctgctgcatattgtgcatg 42113958  T
301 gttattgttctcatgttggaaggttttatcattggtgattaacaaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcct 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113959 gttattgttctcatgttggaaggttttatcattggtgattaacaaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcct 42114058  T
401 cttcaggttgtatcgttggccttcaccgttctatggagtcctgaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtg 500  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42114059 cttcaggttgtgtcgttggccttcaccgttctatggagtcctgaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtg 42114158  T
501 ctg 503  Q
    |||    
42114159 ctg 42114161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 31122 times since January 2019
Visitors: 1588