View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555_high_2 (Length: 377)

Name: NF4555_high_2
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4555_high_2
NF4555_high_2
[»] chr7 (3 HSPs)
chr7 (1-358)||(33755824-33756181)
chr7 (1-354)||(33761804-33762155)
chr7 (251-324)||(33764120-33764193)


Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 33756181 - 33755824
Alignment:
1 gcataagaagattaggatctattaaaaaattgttttgaattaatttttcgatagtttttattcaaaagtttatttgtatcgatgacatacatttccatca 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33756181 gcataagaagattaggatctattaaaaaattgttttgatttaatttttcgatagtttttattcaaaagtttatttgtatcgatgacatacatttccatca 33756082  T
101 atgtgtagaggctgtgatgcatctatccatatagactcaacaaataggactaattcagagaaagaaaatgactcaaacgaaactgttagaggctatgatc 200  Q
    ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
33756081 atgtgtagaggctgtgatgcatctatccacatagactcaaaaaataggactaattcagagaaagaaaatgacgcaaacgaaactgttagaggctatgatc 33755982  T
201 caatggacgagcggaaggaaacaatagaagttatttgtactttaacagtatcatgtgcagacatcataacactggctagaacagatgttctggccttatc 300  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
33755981 caatggacgagcggaaggaaacaatagaagttatttgtcctttaacagtatcatgtgcagacattataacactggctagaacagatgttctggccttatc 33755882  T
301 cggaggaccaaaatacaatgttccgactaagcttgtgaatatgtttgaatcaggtaat 358  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
33755881 cggaggaccaaaatacaatgttccgactaagcttgtgaatttgtttgaatcaggtaat 33755824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 33762155 - 33761804
Alignment:
1 gcataagaagattaggatctattaaaaaattgttttgaattaatttttcgatagtttttattcaaaagtttatttgtatcgatgacatacatttccatca 100  Q
    ||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
33762155 gcataagaagattgggatctattaaaaaattgttttgatttaatttt-cgatagtttttattcaaaagtttatttgtatcgataacatacatttccatca 33762057  T
101 atgtgtagaggctgtgatgcatctatccatatagactcaacaaataggactaattcagagaaagaaaatgactcaaacgaaactgttagaggctatgatc 200  Q
    |||||||| || |||||||||||| | |  |||| |||||||||||| || || ||||||||| |||||||| |||||||||||||||||||||||||||    
33762056 atgtgtaggggttgtgatgcatctcttctcatag-ctcaacaaatagcacgaaatcagagaaataaaatgacgcaaacgaaactgttagaggctatgatc 33761958  T
201 caatggacgagcggaaggaaacaatagaagttatttgtactttaacagtatcatgtgcagacatcataacactggctagaacagatgttctggccttatc 300  Q
     ||| ||||||| |||||||||||| |||||||||||| ||| |||| ||||||||||||||||| |||||||  |||||| ||||||| ||||||||||    
33761957 taatagacgagccgaaggaaacaatcgaagttatttgtccttcaacaatatcatgtgcagacatcttaacactttctagaagagatgttttggccttatc 33761858  T
301 cggaggaccaaaatacaatgttccgactaagcttgtgaatatgtttgaatcagg 354  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||    
33761857 cggaggaccaaaatacaatgttccgactaagcttgtgaaattgtttgaatcagg 33761804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 251 - 324
Target Start/End: Complemental strand, 33764193 - 33764120
Alignment:
251 tcatgtgcagacatcataacactggctagaacagatgttctggccttatccggaggaccaaaatacaatgttcc 324  Q
    ||||||||||||||| || |||| |||| || ||||| | |||||||||| |||||||||||||||||| ||||    
33764193 tcatgtgcagacatcgtagcacttgctacaagagatgctgtggccttatctggaggaccaaaatacaatattcc 33764120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18311 times since January 2019
Visitors: 1568