View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555_high_3 (Length: 301)

Name: NF4555_high_3
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4555_high_3
NF4555_high_3
[»] chr3 (1 HSPs)
chr3 (10-282)||(42113378-42113650)


Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 10 - 282
Target Start/End: Complemental strand, 42113650 - 42113378
Alignment:
10 gcagagattggcttgttgagtaatatctagagagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 109  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113650 gcagagattggcttgttgagtaatatctagggagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 42113551  T
110 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113550 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 42113451  T
210 aacaaagagataaaacagagaggactattaaggaggagattaatgttacggtggtgaggtcgaaagctgaagt 282  Q
    ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
42113450 aacaaagagataaaacagagaggacaattaaggaagagattaatgttacggtggtgaggtcgaaagctgaagt 42113378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199015 times since January 2019
Visitors: 2774