View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555_low_1 (Length: 513)

Name: NF4555_low_1
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4555_low_1
[»] chr3 (1 HSPs)
chr3 (1-503)||(42113659-42114161)

Alignment Details
Target: chr3 (Bit Score: 487; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 1 - 503
Target Start/End: Original strand, 42113659 - 42114161
1 cattgttttttctcttggattctttgaaccagcttttctcttaacgttgttgtttctcctcaacgcttccatcagaaaaaagacaccaaacgacggttgg 100  Q
42113659 cattgttttttctcttggattctttgaaccagcttttctcttaacgttgttgtttctcctcaacgcttccatcagaaaaaagacaccaaacgacggttgg 42113758  T
101 gctgtaacctttgtgtttagcacgtgtcttccattaggtattcttcaaggtttacttgtctatttcaatccattggaacatcgtgttccggcgttgttac 200  Q
42113759 gctgtaacctttgtgtttagcacgtgtcttccattaggtattcttcaaggtttacttgtctatttcaatccattggaacatcgtgttccggcgttgttac 42113858  T
201 gacaaacatttgttattctagaagacgacaccgttctctgcgcttacccgttcttaaacagcgttgtgttcgccgcattcgctgctgcatattgtgcatg 300  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
42113859 gacaaacatttgttattctagaagacgacaccgttctctgtgcttacccgttcttaaacagcgttgtgttcgcggcattctctgctgcatattgtgcatg 42113958  T
301 gttattgttctcatgttggaaggttttatcattggtgattaacaaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcct 400  Q
42113959 gttattgttctcatgttggaaggttttatcattggtgattaacaaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcct 42114058  T
401 cttcaggttgtatcgttggccttcaccgttctatggagtcctgaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtg 500  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42114059 cttcaggttgtgtcgttggccttcaccgttctatggagtcctgaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtg 42114158  T
501 ctg 503  Q
42114159 ctg 42114161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318594 times since January 2019
Visitors: 3039