View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4555_low_3 (Length: 301)

Name: NF4555_low_3
Description: NF4555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4555_low_3
[»] chr3 (1 HSPs)
chr3 (10-282)||(42113378-42113650)

Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 10 - 282
Target Start/End: Complemental strand, 42113650 - 42113378
10 gcagagattggcttgttgagtaatatctagagagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 109  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113650 gcagagattggcttgttgagtaatatctagggagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 42113551  T
110 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 209  Q
42113550 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 42113451  T
210 aacaaagagataaaacagagaggactattaaggaggagattaatgttacggtggtgaggtcgaaagctgaagt 282  Q
    ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
42113450 aacaaagagataaaacagagaggacaattaaggaagagattaatgttacggtggtgaggtcgaaagctgaagt 42113378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 18360 times since January 2019
Visitors: 1568