View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L1_15 (Length: 686)

Name: R108-L1_15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L1_15
R108-L1_15
[»] chr5 (9 HSPs)
chr5 (1-544)||(38866856-38867398)
chr5 (1-337)||(38805650-38805983)
chr5 (537-686)||(38867394-38867543)
chr5 (351-538)||(29426334-29426521)
chr5 (350-542)||(1758872-1759063)
chr5 (341-538)||(29566506-29566703)
chr5 (344-544)||(29169358-29169557)
chr5 (350-527)||(29250445-29250621)
chr5 (345-518)||(32432108-32432280)
[»] chr4 (5 HSPs)
chr4 (348-518)||(27519807-27519976)
chr4 (353-518)||(27463053-27463217)
chr4 (353-518)||(27483425-27483589)
chr4 (360-518)||(27471659-27471816)
chr4 (358-535)||(18987780-18987956)
[»] chr3 (1 HSPs)
chr3 (344-518)||(25520045-25520218)
[»] chr7 (1 HSPs)
chr7 (384-511)||(1699948-1700074)


Alignment Details
Target: chr5 (Bit Score: 504; Significance: 0; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 504; E-Value: 0
Query Start/End: Original strand, 1 - 544
Target Start/End: Complemental strand, 38867398 - 38866856
Alignment:
1 ccaacaattttgaatattgtgatgcatgaataatcactgatatgaactgagtgactcaataatgcattcttttttgccaattgtcatttgacatattatt 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38867398 ccaacaattttgaatattgtgatgcatgaataatcattgatatgaactgagtgactcaataatgcattcttttttgccaattgtcatttgacatattatt 38867299  T
101 caattgtcaaatgaaaagagattgaatgagtgttactaaaagtaccgatttgataatgttttggtctgtttcattcattgaagcaggaacttctcatatt 200  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
38867298 caattgtcaaatgaaaagagattgaattagtgttactaaaagtaccgatttgataatgttttggtctgtttcattcattgaagcaggaacttcacatatt 38867199  T
201 cactatatgcaccttattcaacaacagttttgttttcgttcttcgaaaatggacccttcacacaggcacctagtatgttgagatgcagattctagtatgc 300  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
38867198 cactatatgcaccttattcaacgacagttttgttttcgttcttcgaaaatggacccttcacacaggcacctagtgtgttgagatgcagattctagtatgc 38867099  T
301 agtttccacttctcatcatttggtgtgtatgagtttgccgctaaatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgt 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
38867098 agtttccacttctcatcatttggtgtgtatgagtttgccgctaaatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaagctgt 38866999  T
401 tagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaa 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
38866998 tagtgtggagtgggttgataagagtttaagccttactttcaagtgt-ccatgtggcaagggatatgaggttctaatatgtgcaaacaattgttactacaa 38866900  T
501 gttggtctagaagaatcaaaatgtttaattgattccttggggat 544  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
38866899 gttggtctagaagaatcaaaatgtttaattgattccttggggat 38866856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 38805650 - 38805983
Alignment:
1 ccaacaattttgaatattgtgatgcatgaataatcactgatatgaactgagtgactcaataatgcattcttttttgccaattgtcatttgacatatt-at 99  Q
    |||||||||||||||||||| ||||||||||||||  |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||    
38805650 ccaacaattttgaatattgtaatgcatgaataatctttgatgtgaactgagtgactcaatagtgcattcttttttgccaattgtcatttgacatatttat 38805749  T
100 tcaattgtcaaatgaaaagagattgaatgagtgttactaaaagtaccgatttgataatgttttggtctgtttcattcattgaagcaggaacttctcatat 199  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||| ||||     
38805750 tcaattgtcaaatgaaaagggattgaaggagtgttactaaaagtacccatttgattatgctttggtctgtttcattcattgaagcaggaacttcacatac 38805849  T
200 tcactatatgcaccttattcaacaacagttttgttttcgttcttcgaaaatggacccttcacacaggcacctagtatgttgagatgcagattctagtatg 299  Q
    |||||| ||||||||||||| || ||||||||||||||||||||| ||||| |||     |||||||||| |||| ||||| ||||| ||||  | | ||    
38805850 tcactacatgcaccttattcgacgacagttttgttttcgttcttcaaaaatagac----gacacaggcacttagtgtgttgtgatgcggatttgaatttg 38805945  T
300 cagtttccacttctcatcatttggtgtgtatgagtttg 337  Q
    ||||||||| |||||||||||| |||||||| ||||||    
38805946 cagtttccatttctcatcatttagtgtgtatcagtttg 38805983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 537 - 686
Target Start/End: Complemental strand, 38867543 - 38867394
Alignment:
537 ttggggatatgataaactttgattggtcatcgggtgaaacaaggtctaagtgattattcaatttttggagaacaaatgtgatatattccacattttttag 636  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
38867543 ttggggatatgataaactttgattggtcatcgggtgaaacaaggtctaagtgattattcaatttttagagaacaaatgtgatatattccacattttttag 38867444  T
637 aggacaaaatatcaaagaaattattagttgtttgtttgatatattccaac 686  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
38867443 aggacaaaatatcaaagaaattattagttgtttgtttgatatattccaac 38867394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 351 - 538
Target Start/End: Original strand, 29426334 - 29426521
Alignment:
351 tcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgcca 450  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||    
29426334 tcatttatgtttttgtaggatgaatcgggaaatgattatgaagaagctgttagtgtggagtgggttgataagagtttaaaccttactttcaagtgt-cca 29426432  T
451 tgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatg-tttaattgattcctt 538  Q
    |||||||||||||||||||||||||| | |||| |||||||||||||||||||||| || ||||||||||||| |||||||||||||||    
29426433 tgtggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtgtaaaagaatcaaaatgttttaattgattcctt 29426521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 133; E-Value: 8e-69
Query Start/End: Original strand, 350 - 542
Target Start/End: Original strand, 1758872 - 1759063
Alignment:
350 ttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgcc 449  Q
    ||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||| ||    
1758872 ttcatttttgtttttgtaggatgaattggaaaatgattatgaagaagctgttagtgtggagtgggttgataagtgtttaagccttactttcaaatgt-cc 1758970  T
450 atgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatgtttaattgattccttgggg 542  Q
    ||||||||||||||||||||||||||| | |||| ||||||||||||||||| || |||||||||||||  ||| ||||||||||||||||||    
1758971 atgtggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagctgatctagaagaatcagtatgcttaattgattccttgggg 1759063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 341 - 538
Target Start/End: Complemental strand, 29566703 - 29566506
Alignment:
341 ctaaatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttc 440  Q
    |||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| || ||| ||||| || |||||||||||||||||    
29566703 ctaaatgaattcatttatgtttttgcaggatgaattgggaaatgattatgaagaagctgttagtgtagaatggattgatgagtgtttaagccttactttc 29566604  T
441 aagtgtgccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatg-tttaattgattcctt 538  Q
    |||||| ||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||| || ||||||||||||| |||||||||||||||    
29566603 aagtgt-ccatgtggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtgtaaaagaatcaaaatgttttaattgattcctt 29566506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 344 - 544
Target Start/End: Original strand, 29169358 - 29169557
Alignment:
344 aatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaag 443  Q
    ||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||| || ||| |||||||| |||||||||||||||||| |    
29169358 aatgaattcatttatgattttgtaggatgaattgggaaatgattatgaagaagctgtcagtgtagaatggattgataagtgtttaagccttactttcagg 29169457  T
444 tgtgccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatgtttaattgattccttgggga 543  Q
    ||  ||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||    
29169458 tgc-ccatgtggcaagggatatgagattctaatatgtgcaaacaattgttactacaagttggtctagaagaatcattatgtttaattgattctttgggga 29169556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 350 - 527
Target Start/End: Original strand, 29250445 - 29250621
Alignment:
350 ttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgcc 449  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||| |||| |||||||||||||||||| ||    
29250445 ttcatttatgtttttgtaggatgaattgggaaatgattataaagaagctgttagtgtggagtggattgataagtgtttgagccttactttcaagtgt-cc 29250543  T
450 atgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatgttta 527  Q
    ||| ||||||||||||||||||||||||| |||  ||||||| |||||||||||||| || ||||||||  |||||||    
29250544 atgcggcaagggatatgaggttctaatatgtgctaacaattgctactacaagttggtttacaagaatcagtatgttta 29250621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 86; E-Value: 9e-41
Query Start/End: Original strand, 345 - 518
Target Start/End: Original strand, 32432108 - 32432280
Alignment:
345 atgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagt 444  Q
    |||| ||||||| ||| |||||||||||  |||| | | |||||||||||| |||||||||| |||||| |||| ||| |||||||||||| ||| | ||    
32432108 atgaattcatttttgtgtttgtaggatggtttggcagaagattatgaagaagctgttagtgtagagtggattgaaaagtgtttaagccttatttttaggt 32432207  T
445 gtgccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    || |||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||| |||||||||||    
32432208 gt-ccatgtggcaaggggtatgaggttctaatatgtgcaaacaattgttactacaagttggtgtagaagaatca 32432280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 139; Significance: 2e-72; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 348 - 518
Target Start/End: Complemental strand, 27519976 - 27519807
Alignment:
348 agttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtg 447  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||     
27519976 agttcatttttgtttttgtaggatgaattgggaaatgattatgaagaagctgttagtgtggagtgggttgataagtgtttaagccttactttcaagtgt- 27519878  T
448 ccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    ||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||    
27519877 ccatgtggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtctagaagaatca 27519807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 353 - 518
Target Start/End: Original strand, 27463053 - 27463217
Alignment:
353 atttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatg 452  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||    
27463053 atttttgtttttgtaggatgaattgggaaatgattatgaagaagctgttagtgtggagtgggttgataagtgtttaagccttactttcaagtgt-ccatg 27463151  T
453 tggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    |||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||    
27463152 tggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtctagaagaatca 27463217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 353 - 518
Target Start/End: Original strand, 27483425 - 27483589
Alignment:
353 atttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatg 452  Q
    |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||    
27483425 atttttgtttttgtaggatgaattgggaaatgattatgaagaagctgttagtgtggagtgggttgataagtgtttaagccttactttcaagtgt-ccatg 27483523  T
453 tggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    |||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||    
27483524 tggcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtctagaagaatca 27483589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 360 - 518
Target Start/End: Original strand, 27471659 - 27471816
Alignment:
360 tttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatgtggcaag 459  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
27471659 tttttgtaggatgaattgggaaatgattatgaagaagctgttagtgtggagtgggttgataagtgtttaagccttactttcaagtgt-ccatgtggcaag 27471757  T
460 ggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    ||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||    
27471758 ggatatgaggttctaatctgtgcaaacaattgttactacaagttggtctagaagaatca 27471816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 358 - 535
Target Start/End: Original strand, 18987780 - 18987956
Alignment:
358 tgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatgtggca 457  Q
    |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||    
18987780 tgtttttgtaggatcaattgggaaatgattatgaagaagctgttagtgtggagtggattgataagtgtttaagccttactttcaagtgt-ccatgtggca 18987878  T
458 agggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatcaaaatgtttaattgattc 535  Q
    ||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||  ||| ||||| |||||    
18987879 agggatatgaggttctaatctgtgcaaacaattgttactacaagttggtctagaagaatcagtatgcttaatagattc 18987956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 135; Significance: 5e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 5e-70
Query Start/End: Original strand, 344 - 518
Target Start/End: Original strand, 25520045 - 25520218
Alignment:
344 aatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaag 443  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||    
25520045 aatgagttcatttatgtttttgtaggatgaattgggaaatgattatgaagaagctgttagtgtagagtgggttgataagtgtttaagccttactttcaag 25520144  T
444 tgtgccatgtggcaagggatatgaggttctaatatatgcagacaattgttactacaagttggtctagaagaatca 518  Q
    ||| |||||| |||||||||||||||||||||| | |||| |||||||||||||||||||||| |||||||||||    
25520145 tgt-ccatgtagcaagggatatgaggttctaatctgtgcaaacaattgttactacaagttggtgtagaagaatca 25520218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 52; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 384 - 511
Target Start/End: Complemental strand, 1700074 - 1699948
Alignment:
384 gattatgaagaacctgttagtgtggagtgggttgataagagtttaagccttactttcaagtgtgccatgtggcaagggatatgaggttctaatatatgca 483  Q
    |||| ||||||| |||| ||||| ||||||| ||| ||  |  |||||||||||||||||||| |||||||||||||| ||||||||||| ||||  ||     
1700074 gattttgaagaagctgtgagtgtagagtgggctgaaaaatgcataagccttactttcaagtgt-ccatgtggcaagggctatgaggttcttatatcagcc 1699976  T
484 gacaattgttactacaagttggtctaga 511  Q
     |||||||||| ||||||||||||||||    
1699975 aacaattgttattacaagttggtctaga 1699948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110774 times since January 2019
Visitors: 1335