View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L1_24 (Length: 552)

Name: R108-L1_24
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L1_24
R108-L1_24
[»] chr3 (2 HSPs)
chr3 (1-444)||(12219462-12219908)
chr3 (3-388)||(7425697-7426077)


Alignment Details
Target: chr3 (Bit Score: 352; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 1 - 444
Target Start/End: Original strand, 12219462 - 12219908
Alignment:
1 tttacttctatcaaatatagcattgtgggtacaacagaagcaagaaaccagcaagaaaanggagatcaacagaagcaa-gaaacctgcagaacatgaatt 99  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | |||||| | |  | |  |   |||||||||||||||||    
12219462 tttacttctatcaaatatagcatcgtggatacaacagaagcaagaaaccagcaagaaaaagaagatcagctgttgtagtgtttcctgcagaacatgaatt 12219561  T
100 gctatgaataccaccctattctcttgatgctagatattgcagattgaaaaaaggggaagattgtttatacaacattagccagtatgcgctgaaagtactg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||    
12219562 gctatgaataccaccctattctcttgatgctagatattgcagattgaaaaaaggggaacattgtttatacaactttagccagtatgcgctgaaagtactg 12219661  T
200 aaaatcaagtaaaaaaccgatctcacggtttctttttcattctaattactt-ggagtactatttgtgtttgatttccaattttggacggtcgacactcct 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
12219662 aaaatcaagtaaaaaaccgatctcacggtttctttttcattctaattacttgggagtactatttgtgtttgatttccaattttggacggtcgacactcct 12219761  T
299 ccagcctacgtcataattcattcattccttgtttac-tcatcttttacaatataaagaagatatttataaaattattagaatttctttttccaatccaat 397  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||    
12219762 ccagcctacgtcataattcattcattccttgtttacttcatcttttacaatataaagaaggtatttataaaattattagaatttctttttcaaatcaaat 12219861  T
398 agaaatctgaacatactaaaagtattatccgagtcaaaggtgtgaag 444  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
12219862 agaaatctgaacatactaaaagtattatccgagtcaaaggtgtgaag 12219908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 3 - 388
Target Start/End: Complemental strand, 7426077 - 7425697
Alignment:
3 tacttctatcaaatatagcattgtgggtacaacagaagcaagaaaccagcaagaaaanggagatcaacagaagcaagaaa-cctgcagaacatgaattgc 101  Q
    ||||||||||||||||||| | |||||||||||| |||||||||||||||||||||| ||||||||   |  | |      |||||||||||||||||||    
7426077 tacttctatcaaatatagcttcgtgggtacaacacaagcaagaaaccagcaagaaaaaggagatcagttgttgtagcctttcctgcagaacatgaattgc 7425978  T
102 tatgaataccaccctattctcttgatgctagatattgcagattgaaaaaaggggaagattgtttatacaacattagccagtatgcgctgaaagtactgaa 201  Q
    | | || |||||| ||| ||||||||||||| || ||||||||||| ||||||||| ||||||||||| || ||||  |||||||| |  |||| |||||    
7425977 tctaaagaccaccttatcctcttgatgctagctactgcagattgaagaaaggggaacattgtttatacgactttagatagtatgcgttacaagtgctgaa 7425878  T
202 aatcaagtaaaaaaccgatctcacggtttctttttcattctaattacttggagtactatttgtgtttgatttccaattttggacggtcgacactcctcca 301  Q
    |||||||||||||  | | |||||||  |||||||||||||||||||    || | ||| ||||||||||||||||||||||||  || |||||||| ||    
7425877 aatcaagtaaaaa--caagctcacgg--tctttttcattctaattac---aaggattatatgtgtttgatttccaattttggactatccacactccttca 7425785  T
302 gcctacgtcataattcattcattccttgtttac-tcatcttttacaatataaagaagatatttataaaattattagaatttctttttc 388  Q
     |||| || ||||||||| ||| |||||||||| ||| |||||| || |||||| || ||||||| |||||| | |||||||||||||    
7425784 acctatgtgataattcatccatcccttgtttacttcagcttttaaaagataaagtaggtatttatgaaattagtggaatttctttttc 7425697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203145 times since January 2019
Visitors: 1517