View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2-1 (Length: 722)

Name: R108-L2-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L2-1
R108-L2-1
[»] scaffold0743 (3 HSPs)
scaffold0743 (1-243)||(6136-6377)
scaffold0743 (545-722)||(5963-6140)
scaffold0743 (384-530)||(6373-6518)
[»] chr2 (2 HSPs)
chr2 (213-530)||(30374894-30375203)
chr2 (213-530)||(30376747-30377056)
[»] scaffold1104 (3 HSPs)
scaffold1104 (545-722)||(294-471)
scaffold1104 (319-420)||(1-101)
scaffold1104 (11-52)||(247-288)


Alignment Details
Target: scaffold0743 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: scaffold0743
Description:

Target: scaffold0743; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6136 - 6377
Alignment:
1 gagtcaagggtttgatcatatgttttgcattgaattcaatgtgatgagcttgcttccancagacctagccatctttttgagaggatgttgcatctcacag 100  Q
    |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
6136 gagtcatgggtttgatcatgtgttttgcattgaattcaatgtgatgagcttgcttccat-agacctagccatctttttgagaggatgttgcatctcacag 6234  T
101 cttcgtcaacatgaagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaaatcttgtttctcatcactcataaccaccatcttttc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
6235 cttcgtcaacatgaagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaactcttgtttctcatcactcataaccaccatcttttc 6334  T
201 catctctatgtctctatcgcaccctctctctttccctcaacct 243  Q
    |||||| |||||||||| ||||||||||||  |||||||||||    
6335 catctccatgtctctattgcaccctctctcaatccctcaacct 6377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0743; HSP #2
Raw Score: 170; E-Value: 7e-91
Query Start/End: Original strand, 545 - 722
Target Start/End: Original strand, 5963 - 6140
Alignment:
545 attaatccaagcattcacttccccgattgaaagactcttttgaaaatgaagaaatcgagaactaaataactcacctgagtgacgatgcatcaattgaaag 644  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5963 attaatccaagcattcacttccccgattgaaagactcttttgaaaatgaagaaatcgagaactaaataactcacctgagtgacgatgcatcaattgaaag 6062  T
645 atttgaataccatatctacaaacttcttttttcatatacggagagagatcaaaagaacctttgtgtaagagctgagtc 722  Q
    |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6063 atttgaataccatatctataaactccttttttcatatacggagagagatcaaaagaacctttgtgtaagagctgagtc 6140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0743; HSP #3
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 384 - 530
Target Start/End: Original strand, 6373 - 6518
Alignment:
384 aaccttttaagtgtaagaataagaaaatatcttacatttagt---tgttcttatccatcttattttttaaagttggaaaaaagtttaaatcantatttac 480  Q
    ||||||||||||| ||||||||||||||||||||||||||||   |||||||||| |||||||||| ||||||||| ||||   |||||||| | |||||    
6373 aaccttttaagtgcaagaataagaaaatatcttacatttagtctttgttcttatc-atcttattttataaagttggtaaaag--ttaaatcatt-tttac 6468  T
481 gtttccttgtttagattaagaaatagaaggaaaatttttcaaacccatca 530  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
6469 gtttccttgtttagattaagaaatagaaggaaaatttttcaaacccatca 6518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 176; Significance: 2e-94; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 213 - 530
Target Start/End: Original strand, 30374894 - 30375203
Alignment:
213 tctatcgcaccctctctctttccctcaacctctc--ccaagagctattgtataaacacgaaccgcttaattaggagagaaaaaccttttaagttaggcgt 310  Q
    ||||| ||||||||||||||||||||||||||||  ||||||||||||||| || |||||||||| | ||||||||||||||         |||||| ||    
30374894 tctattgcaccctctctctttccctcaacctctctcccaagagctattgtacaagcacgaaccgcgtgattaggagagaaaa---------gttaggggt 30374984  T
311 aaagtttgtgaaatttgaactattttttgtgatttgatgatcaaactcttaacactacactcatacaaaacaaaaccttttaagtgtaagaataagaaaa 410  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||    
30374985 aaagtttgtgaaatttgaactattttttatgatttgatgatcaaactcttaacactacactggtacaaaacaaaaccttttaagtgcaagaataagaaaa 30375084  T
411 tatcttacatttag---ttgttcttatccatcttattttttaaagttggaaaaaagtttaaatcantatttacgtttccttgtttagattaagaaataga 507  Q
    ||||||||||||||   |||||||||| |||||||||||||||| |||| ||||   |||||||| | |||||||| ||||||||| |||||||||||||    
30375085 tatcttacatttagtctttgttcttat-catcttattttttaaaattggtaaaa--gttaaatcatt-tttacgttaccttgtttacattaagaaataga 30375180  T
508 aggaaaatttttcaaacccatca 530  Q
    |||||||||||||||||||||||    
30375181 aggaaaatttttcaaacccatca 30375203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 213 - 530
Target Start/End: Original strand, 30376747 - 30377056
Alignment:
213 tctatcgcaccctctctctttccctcaacctctc--ccaagagctattgtataaacacgaaccgcttaattaggagagaaaaaccttttaagttaggcgt 310  Q
    ||||| ||||||||||||||||||||||||||||  ||||||||||||||| || |||||||||| | ||||||||||||||         |||||| ||    
30376747 tctattgcaccctctctctttccctcaacctctctcccaagagctattgtacaagcacgaaccgcgtgattaggagagaaaa---------gttaggggt 30376837  T
311 aaagtttgtgaaatttgaactattttttgtgatttgatgatcaaactcttaacactacactcatacaaaacaaaaccttttaagtgtaagaataagaaaa 410  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||    
30376838 aaagttagtgaaatttgaactattttttatgatttgatgatcaaactctaaacactacactgatacaaaacaaaaccttttaagtgcaagaataagaaaa 30376937  T
411 tatcttacatttag---ttgttcttatccatcttattttttaaagttggaaaaaagtttaaatcantatttacgtttccttgtttagattaagaaataga 507  Q
    ||||||||||||||   |||||||||| |||||||||||||||| |||| ||||   |||||||| | |||||||||||||||||| |||||||||||||    
30376938 tatcttacatttagtctttgttcttat-catcttattttttaaaattggtaaaa--gttaaatcatt-tttacgtttccttgtttacattaagaaataga 30377033  T
508 aggaaaatttttcaaacccatca 530  Q
    |||||||||||||||||||||||    
30377034 aggaaaatttttcaaacccatca 30377056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1104 (Bit Score: 98; Significance: 7e-48; HSPs: 3)
Name: scaffold1104
Description:

Target: scaffold1104; HSP #1
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 545 - 722
Target Start/End: Complemental strand, 471 - 294
Alignment:
545 attaatccaagcattcacttccccgattgaaagactcttttgaaaatgaagaaatcgagaactaaataactcacctgagtgacgatgcatcaattgaaag 644  Q
    ||||||| |||||||||||||||||||||||||| |||||| ||||||| ||||||||||| || ||||||||| | ||||||||| |||||||| ||||    
471 attaatctaagcattcacttccccgattgaaagattctttttaaaatgatgaaatcgagaagtagataactcacttaagtgacgatacatcaattaaaag 372  T
645 atttgaataccatatctacaaacttcttttttcatatacggagagagatcaaaagaacctttgtgtaagagctgagtc 722  Q
      ||||||||||||| ||  |||| | ||||||||||| |||||||||||||| ||||||||||||||||| ||||||    
371 gattgaataccatatttaagaactccatttttcatatatggagagagatcaaatgaacctttgtgtaagagttgagtc 294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1104; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 319 - 420
Target Start/End: Complemental strand, 101 - 1
Alignment:
319 tgaaatttgaactattttttgtgatttgatgatcaaactcttaacactacactcatacaaaacaaaaccttttaagtgtaagaataagaaaatatcttac 418  Q
    |||||||||||||||||||  |||||  || |||||||||||||||||| | | ||||||||||||||| | |||||  |||||||||||||||||||||    
101 tgaaatttgaactattttta-tgattaaattatcaaactcttaacactaaattgatacaaaacaaaaccatataagtaaaagaataagaaaatatcttac 3  T
419 at 420  Q
    ||    
2 at 1  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1104; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 288 - 247
Alignment:
11 tttgatcatatgttttgcattgaattcaatgtgatgagcttg 52  Q
    ||||||||||||||||||||||||||||||||||||||||||    
288 tttgatcatatgttttgcattgaattcaatgtgatgagcttg 247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203025 times since January 2019
Visitors: 1517