View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2_11 (Length: 453)

Name: R108-L2_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L2_11
R108-L2_11
[»] chr4 (3 HSPs)
chr4 (1-307)||(53865909-53866215)
chr4 (301-453)||(53865761-53865913)
chr4 (309-388)||(54161453-54161532)


Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 53865909 - 53866215
Alignment:
1 gagaaaatgtttgcatgatatagttatatacttatatggacttaatgaacaggtaaacgttccggttatagtcgctgcctgcaagcttgacttacaacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53865909 gagaaaatgtttgcatgatatagttatatacttatatggacttaatgaacaggtaaacgttccggttatagtcgctgcctgcaagcttgacttacaacat 53866008  T
101 gataatcaagaggagagcttagaagacgttgaaatcactattcgttgttcagcatatacaactataggggtatatatatatccttcatattattacaatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
53866009 gataatcaagaggagagcttagaagacgttgaaatcactattcgttgttcagcatatacaactatgggggtatatatatatccttcatattattacaatc 53866108  T
201 aacaacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53866109 aacaacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgt 53866208  T
301 caattgt 307  Q
    |||||||    
53866209 caattgt 53866215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 301 - 453
Target Start/End: Original strand, 53865761 - 53865913
Alignment:
301 caattgttctcacatatgcatgtgatcggcaagagacacttgaaagactgagttcattttggctcccgcgtcttcgcgatttaggggttctgttctctcc 400  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53865761 caattgttctcacatatacatgtgatcggcaagagacacttgaaagactgagttcattttggctcccgcgtcttcgcgatttaggggttctgttctctcc 53865860  T
401 tcttttttccatctacactttgttactattgtacactgcatttgtattgagaa 453  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
53865861 tcttttttccatctacactttgttactattgtacactgcatttgcattgagaa 53865913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 309 - 388
Target Start/End: Complemental strand, 54161532 - 54161453
Alignment:
309 ctcacatatgcatgtgatcggcaagagacacttgaaagactgagttcattttggctcccgcgtcttcgcgatttaggggt 388  Q
    ||||| |||||||||||||| ||||  ||||||||||| |||| | ||||||||||||| |||||||||||||| |||||    
54161532 ctcacctatgcatgtgatcgccaagccacacttgaaagtctgactgcattttggctccctcgtcttcgcgatttgggggt 54161453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360297 times since January 2019
Visitors: 482