View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2_14 (Length: 361)

Name: R108-L2_14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L2_14
R108-L2_14
[»] scaffold0743 (2 HSPs)
scaffold0743 (175-361)||(6136-6322)
scaffold0743 (1-174)||(5967-6140)
[»] scaffold1104 (2 HSPs)
scaffold1104 (1-170)||(294-463)
scaffold1104 (310-351)||(247-288)


Alignment Details
Target: scaffold0743 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: scaffold0743
Description:

Target: scaffold0743; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 175 - 361
Target Start/End: Complemental strand, 6322 - 6136
Alignment:
175 gttatgagtgatgagaaacaagattttatcaacaagcttccaaatgacgtcttaaccttcatcctttccaaacttcatgttgacgaagctgtgagatgca 274  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
6322 gttatgagtgatgagaaacaagagtttatcaacaagcttccaaatgatgtcttaaccttcatcctttccaaacttcatgttgacgaagctgtgagatgca 6223  T
275 acatcctctcaaaaagatggctaggtctttggaagcaagctcatcacattgaattcaatgcaaaacatatgatcaaacccttgactc 361  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
6222 acatcctctcaaaaagatggctaggtctatggaagcaagctcatcacattgaattcaatgcaaaacacatgatcaaacccatgactc 6136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0743; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 6140 - 5967
Alignment:
1 gactcagctcttacacaaaggttcttttgacctccctccgtatatgaaaaaagaagtttgtagatatggtattcaaatctttcaactgatgcatcgtcac 100  Q
    |||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||    
6140 gactcagctcttacacaaaggttcttttgatctctctccgtatatgaaaaaaggagtttatagatatggtattcaaatctttcaattgatgcatcgtcac 6041  T
101 tcaggtgagttatttagttctcgatttcttcattttcaaaagagtctttcaatcggggaagtgaatgcttggat 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6040 tcaggtgagttatttagttctcgatttcttcattttcaaaagagtctttcaatcggggaagtgaatgcttggat 5967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1104 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold1104
Description:

Target: scaffold1104; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 294 - 463
Alignment:
1 gactcagctcttacacaaaggttcttttgacctccctccgtatatgaaaaaagaagtttgtagatatggtattcaaatctttcaactgatgcatcgtcac 100  Q
    |||||| ||||||||||||||||| ||||| ||| |||| ||||||||||| | ||||  || |||||||||||||  |||| || ||||| ||||||||    
294 gactcaactcttacacaaaggttcatttgatctctctccatatatgaaaaatggagttcttaaatatggtattcaatccttttaattgatgtatcgtcac 393  T
101 tcaggtgagttatttagttctcgatttcttcattttcaaaagagtctttcaatcggggaagtgaatgctt 170  Q
    | | ||||||||| || ||||||||||| ||||||| |||||| ||||||||||||||||||||||||||    
394 ttaagtgagttatctacttctcgatttcatcattttaaaaagaatctttcaatcggggaagtgaatgctt 463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1104; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 310 - 351
Target Start/End: Original strand, 247 - 288
Alignment:
310 caagctcatcacattgaattcaatgcaaaacatatgatcaaa 351  Q
    ||||||||||||||||||||||||||||||||||||||||||    
247 caagctcatcacattgaattcaatgcaaaacatatgatcaaa 288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361775 times since January 2019
Visitors: 488