View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2_15 (Length: 122)

Name: R108-L2_15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] R108-L2_15
[»] chr1 (1 HSPs)
chr1 (1-97)||(34668245-34668341)

Alignment Details
Target: chr1 (Bit Score: 73; Significance: 8e-34; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 34668245 - 34668341
1 ctgataccacattaagtatgattatttgattatctttcttgttcataacttttagcagtttatattgatgtacaattctgatttgtaggcaattgta 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || |||||||||||||||| |||||||||| ||||||||    
34668245 ctgataccacattaagtatgattatttgattatctttcttgttcaaaactgttagcaattaatattgatgtacaattttgatttgtagacaattgta 34668341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 110952 times since January 2019
Visitors: 1335