View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2_18 (Length: 204)

Name: R108-L2_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L2_18
R108-L2_18
[»] chr3 (1 HSPs)
chr3 (1-204)||(37817768-37817968)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 37817768 - 37817968
Alignment:
1 ttttatggggaagcaggtaatgagagaggagacttaatttgttaacatgacacaaaggttgttttgagatattttactgatgtttttgttgatatcatgt 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
37817768 ttttatggggaagaaggtaatgagagaggagacttaatttgttaacatgacacaaaggttgttttgagttattttactgatgtttttgttgatatcatgt 37817867  T
101 aataggaatgaaatannattatgatttataagcnaagctctaccctctgtgttctttatcaaagtattannnnnnngcaagtgtgatctttataattata 200  Q
    |||||||||||||||  ||||||| |||||||| |||||||||||||||||||| ||||||||||||||       ||||||||||||||||||||||||    
37817868 aataggaatgaaata-gattatga-ttataagcaaagctctaccctctgtgttc-ttatcaaagtattatttttttgcaagtgtgatctttataattata 37817964  T
201 tatt 204  Q
    ||||    
37817965 tatt 37817968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175919 times since January 2019
Visitors: 1577