View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L2_55 (Length: 398)

Name: R108-L2_55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L2_55
R108-L2_55
[»] chr3 (2 HSPs)
chr3 (1-227)||(47835193-47835414)
chr3 (222-396)||(47835022-47835196)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 47835193 - 47835414
Alignment:
1 aatttctcccaatcgaataatcgccgccttaaattccattccactgccacaaccacaattctccgctccactgtcccatctctgatacagtagcatactt 100  Q
    |||| |||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835193 aattcctcccaatcgaataatcgccgccttaaattc-----cactgccacaaccacaattctccgctccactgtcccatctctgatacagtagcatactt 47835287  T
101 attctctgcaactgagtacaacctcggatatacatgcattagtggttccggtcccacccatttatagtgccaattttaattttctctcctctgccaagcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835288 attctctgcaactgagtacaacctcggatatacatgcattagtggttccggtcccacccatttatagtgccaattttaattttctctcctctgccaagcc 47835387  T
201 ttaaactaatgccatcaacaaactagt 227  Q
    |||||||||||||||||||||||||||    
47835388 ttaaactaatgccatcaacaaactagt 47835414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 222 - 396
Target Start/End: Original strand, 47835022 - 47835196
Alignment:
222 actagtcccatctcattttttactgttaaataattgttactctgcagctaaattgtgtacccggacctgacagattaacctcctgccacatctagcttcc 321  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835022 actagtcccatctcattttttactgttaaataattgttactctgcagctaaattgtgtacccggacctgacagattaacctcctgccacatctagcttcc 47835121  T
322 acacccacctgtcatgctcccttcagttccgtgaaatctcctgcaacaaaatttataattctctgcttagcaatt 396  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835122 acacccacctgtcatgctcccttcagttccgtgaaatctcctgcaacaaaatttataattctctgcttagcaatt 47835196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110939 times since January 2019
Visitors: 1335