View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L3_1 (Length: 66)

Name: R108-L3_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] R108-L3_1
[»] chr3 (1 HSPs)
chr3 (1-56)||(33630903-33630958)

Alignment Details
Target: chr3 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 33630958 - 33630903
1 catcacccttaaatcaaatatttcatttagtagcggtaaatacatcaattaatatt 56  Q
33630958 catcacccttaaatcaaatatttcatttagtagcggtaaatacatcaattaatatt 33630903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 310002 times since January 2019
Visitors: 444