View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L3_2 (Length: 797)

Name: R108-L3_2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L3_2
R108-L3_2
[»] chr3 (69 HSPs)
chr3 (430-797)||(38927823-38928190)
chr3 (1-196)||(38927630-38927827)
chr3 (428-614)||(37600127-37600313)
chr3 (195-310)||(38927116-38927231)
chr3 (427-614)||(10769722-10769909)
chr3 (432-614)||(54140890-54141072)
chr3 (426-611)||(27243040-27243225)
chr3 (476-608)||(24748913-24749045)
chr3 (513-614)||(29775139-29775238)
chr3 (440-567)||(46237090-46237217)
chr3 (428-613)||(24734702-24734886)
chr3 (425-613)||(41451894-41452081)
chr3 (543-612)||(27243047-27243116)
chr3 (547-619)||(37600243-37600315)
chr3 (432-611)||(13809083-13809261)
chr3 (537-614)||(20493548-20493625)
chr3 (478-611)||(20791343-20791475)
chr3 (462-601)||(357791-357928)
chr3 (547-614)||(10769838-10769905)
chr3 (547-614)||(28529253-28529320)
chr3 (424-605)||(28529246-28529424)
chr3 (547-608)||(46237159-46237220)
chr3 (451-607)||(43657000-43657156)
chr3 (547-614)||(5452173-5452240)
chr3 (426-529)||(21232604-21232707)
chr3 (426-613)||(37776702-37776888)
chr3 (547-618)||(52951372-52951443)
chr3 (547-605)||(54141006-54141064)
chr3 (543-619)||(46160944-46161018)
chr3 (543-612)||(50661631-50661700)
chr3 (428-613)||(5452061-5452243)
chr3 (547-614)||(21232635-21232702)
chr3 (550-613)||(52123955-52124018)
chr3 (476-578)||(50661555-50661657)
chr3 (549-611)||(52951475-52951537)
chr3 (476-613)||(29588732-29588868)
chr3 (537-614)||(37776806-37776883)
chr3 (424-500)||(37600120-37600196)
chr3 (541-613)||(40715969-40716041)
chr3 (547-619)||(46575943-46576015)
chr3 (428-500)||(54140887-54140959)
chr3 (552-603)||(29235658-29235709)
chr3 (547-614)||(29389126-29389193)
chr3 (426-496)||(29775134-29775202)
chr3 (560-614)||(30624633-30624685)
chr3 (547-613)||(13809083-13809148)
chr3 (547-613)||(24749023-24749089)
chr3 (478-611)||(14236066-14236198)
chr3 (428-605)||(20493452-20493628)
chr3 (431-500)||(38928006-38928075)
chr3 (551-588)||(46156741-46156778)
chr3 (428-620)||(46575945-46576135)
chr3 (554-603)||(54187050-54187099)
chr3 (428-500)||(10769719-10769791)
chr3 (552-604)||(13639412-13639464)
chr3 (547-614)||(46450067-46450132)
chr3 (552-604)||(48543262-48543314)
chr3 (526-612)||(15790370-15790454)
chr3 (547-614)||(20791296-20791363)
chr3 (549-620)||(24734699-24734770)
chr3 (547-614)||(38928122-38928189)
chr3 (550-613)||(44844100-44844163)
chr3 (547-614)||(45515608-45515675)
chr3 (547-588)||(26310559-26310600)
chr3 (559-620)||(30624746-30624807)
chr3 (480-585)||(37926580-37926685)
chr3 (549-614)||(41452010-41452075)
chr3 (547-596)||(41707552-41707601)
chr3 (560-613)||(50320541-50320594)
[»] chr1 (75 HSPs)
chr1 (426-621)||(11430436-11430630)
chr1 (426-612)||(11135734-11135920)
chr1 (426-621)||(32848573-32848768)
chr1 (432-614)||(41095606-41095788)
chr1 (428-614)||(14093998-14094184)
chr1 (431-576)||(41917995-41918140)
chr1 (476-614)||(13388334-13388474)
chr1 (476-619)||(29418526-29418670)
chr1 (476-613)||(50773109-50773246)
chr1 (432-611)||(13114670-13114849)
chr1 (547-619)||(41917990-41918062)
chr1 (490-583)||(24436495-24436588)
chr1 (478-619)||(43832316-43832457)
chr1 (547-614)||(11135739-11135806)
chr1 (476-611)||(50424866-50425001)
chr1 (547-613)||(41095722-41095788)
chr1 (488-619)||(30678904-30679034)
chr1 (476-603)||(15660938-15661063)
chr1 (550-614)||(32848699-32848763)
chr1 (547-614)||(11430441-11430508)
chr1 (431-611)||(19101602-19101781)
chr1 (448-614)||(28109885-28110050)
chr1 (427-529)||(43851117-43851219)
chr1 (547-611)||(4578690-4578752)
chr1 (537-614)||(9165302-9165379)
chr1 (547-620)||(44739112-44739185)
chr1 (548-620)||(25543334-25543406)
chr1 (457-613)||(41948145-41948300)
chr1 (548-613)||(13114784-13114849)
chr1 (518-613)||(8899101-8899195)
chr1 (547-614)||(14094114-14094181)
chr1 (547-614)||(26980375-26980442)
chr1 (428-543)||(44739115-44739230)
chr1 (548-614)||(6133738-6133804)
chr1 (426-500)||(11135853-11135927)
chr1 (543-597)||(28109885-28109939)
chr1 (549-614)||(39039470-39039535)
chr1 (561-617)||(3872760-3872816)
chr1 (552-588)||(24886063-24886099)
chr1 (428-612)||(26980262-26980445)
chr1 (428-500)||(41095603-41095675)
chr1 (548-608)||(50773225-50773285)
chr1 (547-614)||(19101714-19101781)
chr1 (431-611)||(22540368-22540543)
chr1 (547-614)||(22540368-22540435)
chr1 (547-614)||(43851148-43851215)
chr1 (547-613)||(18157039-18157105)
chr1 (553-603)||(28274797-28274847)
chr1 (476-588)||(4578599-4578712)
chr1 (577-614)||(13889289-13889326)
chr1 (428-500)||(11430555-11430626)
chr1 (550-614)||(21466687-21466751)
chr1 (553-613)||(24886159-24886219)
chr1 (553-613)||(29068200-29068260)
chr1 (547-614)||(39019575-39019636)
chr1 (567-611)||(39019702-39019746)
chr1 (549-585)||(50308786-50308822)
chr1 (432-500)||(50773109-50773177)
chr1 (547-614)||(15523210-15523277)
chr1 (547-614)||(15531204-15531271)
chr1 (560-619)||(16948522-16948581)
chr1 (553-588)||(19078937-19078972)
chr1 (553-588)||(19126825-19126860)
chr1 (552-603)||(29068089-29068140)
chr1 (550-613)||(39974199-39974262)
chr1 (548-587)||(50424980-50425019)
chr1 (560-614)||(931374-931428)
chr1 (559-613)||(6133624-6133678)
chr1 (550-611)||(15928673-15928732)
chr1 (550-604)||(25543457-25543511)
chr1 (563-613)||(29663575-29663625)
chr1 (428-501)||(9165299-9165372)
chr1 (550-611)||(12767329-12767390)
chr1 (547-576)||(13388452-13388481)
chr1 (434-499)||(50424866-50424931)
[»] chr6 (41 HSPs)
chr6 (428-614)||(19090212-19090398)
chr6 (434-618)||(35128720-35128900)
chr6 (428-608)||(10060856-10061036)
chr6 (441-614)||(19737432-19737605)
chr6 (428-617)||(6531296-6531481)
chr6 (428-588)||(373396-373556)
chr6 (457-613)||(4595768-4595922)
chr6 (431-611)||(21987292-21987471)
chr6 (547-619)||(19090328-19090400)
chr6 (547-614)||(6531411-6531478)
chr6 (476-612)||(34905381-34905516)
chr6 (547-611)||(35128836-35128900)
chr6 (547-613)||(34905337-34905403)
chr6 (547-620)||(10060853-10060926)
chr6 (440-616)||(12794809-12794985)
chr6 (423-500)||(19090204-19090281)
chr6 (478-613)||(1392675-1392808)
chr6 (552-619)||(10133276-10133343)
chr6 (547-606)||(31116237-31116296)
chr6 (527-585)||(9940387-9940445)
chr6 (550-619)||(8441953-8442022)
chr6 (550-619)||(8450757-8450826)
chr6 (547-604)||(19737548-19737605)
chr6 (552-604)||(32439486-32439538)
chr6 (547-614)||(373399-373466)
chr6 (543-614)||(12690252-12690323)
chr6 (510-576)||(6992306-6992372)
chr6 (550-624)||(17226645-17226719)
chr6 (547-588)||(4595768-4595809)
chr6 (561-614)||(12753758-12753811)
chr6 (426-588)||(445813-445974)
chr6 (440-588)||(31116148-31116295)
chr6 (547-614)||(445818-445885)
chr6 (547-614)||(21987292-21987359)
chr6 (132-190)||(27096360-27096418)
chr6 (547-604)||(5106308-5106365)
chr6 (559-604)||(8441857-8441902)
chr6 (559-604)||(8450661-8450706)
chr6 (575-608)||(12794955-12794988)
chr6 (566-611)||(29423350-29423395)
chr6 (548-613)||(32122796-32122861)
[»] chr5 (54 HSPs)
chr5 (427-619)||(42224583-42224775)
chr5 (426-611)||(40971453-40971638)
chr5 (428-611)||(4959275-4959458)
chr5 (434-614)||(26072106-26072286)
chr5 (422-614)||(17568699-17568891)
chr5 (441-611)||(6263893-6264061)
chr5 (457-619)||(32050333-32050495)
chr5 (432-614)||(8912511-8912695)
chr5 (476-620)||(24915100-24915242)
chr5 (476-620)||(24990931-24991073)
chr5 (426-608)||(13456170-13456348)
chr5 (476-613)||(34818231-34818368)
chr5 (428-613)||(28611777-28611961)
chr5 (547-619)||(4959273-4959345)
chr5 (547-614)||(42224704-42224771)
chr5 (547-614)||(40971566-40971633)
chr5 (548-614)||(6263883-6263949)
chr5 (422-499)||(26072218-26072295)
chr5 (547-611)||(26072106-26072170)
chr5 (431-603)||(30325883-30326054)
chr5 (428-619)||(34368357-34368547)
chr5 (547-613)||(31542356-31542422)
chr5 (423-500)||(42224580-42224657)
chr5 (476-588)||(10142000-10142111)
chr5 (559-607)||(28490727-28490775)
chr5 (553-613)||(30892229-30892289)
chr5 (559-614)||(28611903-28611958)
chr5 (547-614)||(30325987-30326054)
chr5 (550-613)||(41105569-41105632)
chr5 (427-501)||(4959391-4959465)
chr5 (422-500)||(6263995-6264073)
chr5 (441-611)||(27592453-27592622)
chr5 (550-620)||(28223768-28223838)
chr5 (431-501)||(32050420-32050490)
chr5 (547-620)||(1649544-1649617)
chr5 (561-614)||(2443686-2443739)
chr5 (524-577)||(27726832-27726885)
chr5 (547-611)||(12076063-12076127)
chr5 (552-603)||(5990638-5990689)
chr5 (548-611)||(17568816-17568879)
chr5 (537-588)||(25710575-25710626)
chr5 (547-614)||(27592565-27592632)
chr5 (559-614)||(34368360-34368415)
chr5 (552-586)||(18237255-18237289)
chr5 (549-619)||(28490837-28490907)
chr5 (566-608)||(29155522-29155564)
chr5 (565-611)||(32401251-32401297)
chr5 (571-613)||(40926184-40926226)
chr5 (550-611)||(2201589-2201650)
chr5 (552-613)||(8912511-8912572)
chr5 (547-588)||(16875378-16875419)
chr5 (428-500)||(24915169-24915239)
chr5 (428-500)||(24991000-24991070)
chr5 (547-619)||(36494218-36494291)
[»] chr7 (84 HSPs)
chr7 (427-614)||(13919776-13919963)
chr7 (429-611)||(45909453-45909636)
chr7 (428-614)||(26703437-26703621)
chr7 (426-613)||(25428477-25428664)
chr7 (470-614)||(19840882-19841026)
chr7 (429-579)||(19494371-19494521)
chr7 (422-614)||(14759634-14759826)
chr7 (432-611)||(24539123-24539302)
chr7 (423-573)||(22786143-22786293)
chr7 (428-576)||(17354562-17354710)
chr7 (432-611)||(17749695-17749874)
chr7 (428-623)||(27888279-27888473)
chr7 (488-605)||(26189960-26190077)
chr7 (220-288)||(10477729-10477797)
chr7 (530-621)||(37549617-37549708)
chr7 (547-614)||(17354640-17354707)
chr7 (426-613)||(22189934-22190120)
chr7 (547-614)||(22786151-22786218)
chr7 (547-613)||(13919781-13919847)
chr7 (427-607)||(33008100-33008276)
chr7 (549-620)||(31502579-31502650)
chr7 (549-611)||(2520636-2520698)
chr7 (537-621)||(32205072-32205153)
chr7 (548-613)||(24539237-24539302)
chr7 (547-619)||(26703553-26703623)
chr7 (547-619)||(19422947-19423019)
chr7 (550-614)||(33008104-33008168)
chr7 (426-585)||(10619419-10619576)
chr7 (547-614)||(19494452-19494519)
chr7 (547-614)||(25428592-25428659)
chr7 (548-614)||(10619506-10619571)
chr7 (547-617)||(14795128-14795198)
chr7 (547-617)||(15242120-15242190)
chr7 (548-613)||(17749695-17749760)
chr7 (547-620)||(27888276-27888349)
chr7 (428-500)||(13919894-13919966)
chr7 (425-497)||(19840876-19840948)
chr7 (561-613)||(27949402-27949454)
chr7 (553-613)||(41873435-41873495)
chr7 (430-611)||(48374440-48374618)
chr7 (547-614)||(22189939-22190006)
chr7 (547-618)||(32212982-32213053)
chr7 (552-603)||(43930078-43930129)
chr7 (440-603)||(47821990-47822153)
chr7 (547-613)||(31959970-31960036)
chr7 (556-621)||(2520712-2520777)
chr7 (559-612)||(6580002-6580055)
chr7 (550-611)||(20954798-20954859)
chr7 (512-569)||(21963172-21963229)
chr7 (549-610)||(27949277-27949338)
chr7 (462-613)||(46517322-46517472)
chr7 (553-606)||(47822101-47822154)
chr7 (431-610)||(32212872-32213049)
chr7 (547-614)||(45909455-45909523)
chr7 (480-574)||(46067987-46068079)
chr7 (547-613)||(11824072-11824138)
chr7 (547-609)||(23934022-23934084)
chr7 (426-496)||(26190021-26190091)
chr7 (510-588)||(26459072-26459150)
chr7 (430-500)||(26703436-26703506)
chr7 (547-613)||(42887741-42887807)
chr7 (550-608)||(46994366-46994424)
chr7 (247-288)||(6953989-6954030)
chr7 (462-609)||(11692210-11692356)
chr7 (560-613)||(39254211-39254264)
chr7 (569-614)||(42863569-42863614)
chr7 (547-611)||(46067940-46068005)
chr7 (440-500)||(25428485-25428545)
chr7 (428-606)||(32205076-32205250)
chr7 (428-500)||(37549621-37549693)
chr7 (550-613)||(6442283-6442346)
chr7 (548-611)||(14759646-14759709)
chr7 (526-613)||(34281017-34281104)
chr7 (553-604)||(36738579-36738630)
chr7 (550-613)||(44350801-44350864)
chr7 (547-610)||(44511049-44511112)
chr7 (547-613)||(27320226-27320292)
chr7 (432-502)||(31959966-31960036)
chr7 (434-500)||(45909570-45909636)
chr7 (547-620)||(46517287-46517358)
chr7 (547-588)||(7775026-7775067)
chr7 (552-613)||(25980750-25980811)
chr7 (510-567)||(31959860-31959917)
chr7 (550-599)||(32055591-32055640)
[»] chr2 (73 HSPs)
chr2 (426-617)||(28898031-28898222)
chr2 (431-614)||(42182889-42183072)
chr2 (425-619)||(37228492-37228687)
chr2 (428-608)||(1110195-1110375)
chr2 (427-613)||(4964671-4964857)
chr2 (427-588)||(31395468-31395629)
chr2 (427-620)||(15508910-15509103)
chr2 (431-620)||(37398805-37398994)
chr2 (427-606)||(24895272-24895449)
chr2 (547-614)||(42182889-42182956)
chr2 (490-628)||(6315717-6315855)
chr2 (528-613)||(27968919-27969004)
chr2 (528-613)||(28091583-28091668)
chr2 (528-613)||(28101815-28101900)
chr2 (522-619)||(37719829-37719926)
chr2 (547-614)||(28898150-28898217)
chr2 (547-619)||(1110193-1110265)
chr2 (553-613)||(37228499-37228559)
chr2 (547-614)||(15508914-15508981)
chr2 (531-625)||(20951595-20951687)
chr2 (432-619)||(44274236-44274421)
chr2 (547-613)||(1107039-1107105)
chr2 (547-617)||(45554564-45554634)
chr2 (426-611)||(12989186-12989370)
chr2 (547-614)||(4964786-4964853)
chr2 (424-613)||(26767760-26767948)
chr2 (547-614)||(31395558-31395625)
chr2 (548-614)||(40535104-40535170)
chr2 (548-621)||(37398928-37399001)
chr2 (549-613)||(6980235-6980299)
chr2 (426-537)||(18511283-18511394)
chr2 (547-614)||(18511322-18511389)
chr2 (547-614)||(41805889-41805956)
chr2 (547-613)||(3804585-3804651)
chr2 (547-613)||(9470082-9470148)
chr2 (548-614)||(11539423-11539489)
chr2 (547-620)||(19427360-19427431)
chr2 (549-606)||(8009521-8009578)
chr2 (478-611)||(38104295-38104427)
chr2 (440-516)||(1107047-1107123)
chr2 (553-613)||(5139969-5140029)
chr2 (428-500)||(6315772-6315844)
chr2 (550-613)||(6980119-6980182)
chr2 (547-614)||(12989191-12989258)
chr2 (547-614)||(26767874-26767941)
chr2 (552-618)||(19190626-19190692)
chr2 (427-497)||(40535104-40535174)
chr2 (547-613)||(44274236-44274301)
chr2 (569-614)||(19193500-19193545)
chr2 (428-500)||(20951603-20951673)
chr2 (550-611)||(38464281-38464342)
chr2 (547-614)||(10339768-10339833)
chr2 (524-584)||(21447197-21447257)
chr2 (480-608)||(23463829-23463957)
chr2 (428-500)||(37228613-37228685)
chr2 (428-500)||(37719831-37719903)
chr2 (554-614)||(41546147-41546207)
chr2 (548-588)||(42579771-42579811)
chr2 (547-622)||(14715740-14715815)
chr2 (547-614)||(23463939-23464006)
chr2 (553-611)||(31494211-31494267)
chr2 (547-614)||(33678228-33678295)
chr2 (554-584)||(7709776-7709806)
chr2 (572-614)||(29806185-29806227)
chr2 (569-611)||(30706407-30706449)
chr2 (490-576)||(33746955-33747041)
chr2 (552-586)||(37285234-37285268)
chr2 (428-506)||(41805881-41805959)
chr2 (550-611)||(25238278-25238339)
chr2 (432-493)||(27968919-27968980)
chr2 (432-493)||(28091607-28091668)
chr2 (432-493)||(28101839-28101900)
chr2 (431-500)||(28898034-28898103)
[»] chr4 (72 HSPs)
chr4 (428-614)||(42862418-42862604)
chr4 (426-611)||(13069936-13070120)
chr4 (427-614)||(44832459-44832646)
chr4 (441-619)||(2187806-2187983)
chr4 (444-588)||(16178597-16178740)
chr4 (427-620)||(37315559-37315749)
chr4 (429-614)||(47237734-47237923)
chr4 (490-614)||(51206102-51206226)
chr4 (447-613)||(30866930-30867096)
chr4 (478-613)||(39016710-39016845)
chr4 (425-613)||(8108950-8109137)
chr4 (548-612)||(40812039-40812103)
chr4 (440-578)||(2088698-2088836)
chr4 (547-613)||(8108957-8109023)
chr4 (476-585)||(41278644-41278753)
chr4 (547-613)||(37315564-37315627)
chr4 (480-611)||(19447180-19447311)
chr4 (547-617)||(43771123-43771193)
chr4 (548-614)||(47237855-47237921)
chr4 (428-573)||(40812034-40812179)
chr4 (548-619)||(40991703-40991774)
chr4 (547-614)||(42862534-42862601)
chr4 (431-613)||(43771126-43771307)
chr4 (547-608)||(2088778-2088839)
chr4 (480-601)||(25719123-25719244)
chr4 (428-497)||(42862415-42862484)
chr4 (553-613)||(37306405-37306465)
chr4 (547-614)||(13069941-13070007)
chr4 (429-500)||(51206157-51206228)
chr4 (547-613)||(2187926-2187992)
chr4 (560-610)||(20454666-20454716)
chr4 (547-613)||(39016664-39016730)
chr4 (426-516)||(48608075-48608165)
chr4 (543-614)||(20225450-20225519)
chr4 (428-500)||(44832577-44832649)
chr4 (553-613)||(51475163-51475223)
chr4 (550-613)||(26361307-26361370)
chr4 (547-614)||(44832463-44832530)
chr4 (547-609)||(16178589-16178650)
chr4 (537-599)||(21776948-21777010)
chr4 (495-608)||(5545642-5545755)
chr4 (247-288)||(18184059-18184100)
chr4 (550-606)||(754586-754642)
chr4 (553-613)||(6540345-6540405)
chr4 (543-603)||(24106756-24106816)
chr4 (552-604)||(39810529-39810581)
chr4 (547-619)||(50571859-50571931)
chr4 (550-605)||(722275-722330)
chr4 (559-614)||(24834705-24834760)
chr4 (547-609)||(25719226-25719286)
chr4 (552-603)||(31699598-31699649)
chr4 (462-613)||(34129399-34129549)
chr4 (547-614)||(39471157-39471224)
chr4 (550-613)||(39471275-39471338)
chr4 (526-585)||(49738950-49739009)
chr4 (547-614)||(50164395-50164462)
chr4 (547-609)||(20454545-20454607)
chr4 (446-608)||(21776848-21777010)
chr4 (547-613)||(24834579-24834645)
chr4 (559-613)||(27654478-27654532)
chr4 (549-611)||(27654595-27654657)
chr4 (553-611)||(33787989-33788047)
chr4 (550-608)||(40991593-40991651)
chr4 (559-609)||(48339465-48339515)
chr4 (573-611)||(51904616-51904654)
chr4 (569-619)||(53870998-53871048)
chr4 (427-500)||(13070054-13070127)
chr4 (428-540)||(20225412-20225522)
chr4 (547-608)||(22592310-22592371)
chr4 (431-500)||(37315674-37315743)
chr4 (560-613)||(38537512-38537565)
chr4 (559-612)||(48339340-48339393)
[»] chr8 (50 HSPs)
chr8 (433-611)||(1205829-1206007)
chr8 (428-610)||(7599423-7599605)
chr8 (432-602)||(35689481-35689651)
chr8 (432-611)||(6387564-6387741)
chr8 (478-614)||(13407321-13407457)
chr8 (428-588)||(33417680-33417839)
chr8 (510-610)||(12212126-12212226)
chr8 (510-610)||(12456554-12456654)
chr8 (479-613)||(28211885-28212018)
chr8 (428-613)||(1977172-1977356)
chr8 (490-623)||(34303426-34303559)
chr8 (550-613)||(16983512-16983575)
chr8 (488-588)||(25915086-25915188)
chr8 (478-552)||(43026338-43026412)
chr8 (547-612)||(1205829-1205894)
chr8 (510-614)||(23142815-23142916)
chr8 (547-604)||(35689490-35689547)
chr8 (559-619)||(8914766-8914826)
chr8 (559-610)||(5980006-5980057)
chr8 (547-613)||(6387564-6387628)
chr8 (547-614)||(7599535-7599602)
chr8 (560-614)||(31691637-31691691)
chr8 (547-613)||(32072098-32072164)
chr8 (547-588)||(44709297-44709338)
chr8 (547-619)||(1977286-1977358)
chr8 (559-605)||(24055932-24055978)
chr8 (547-617)||(28413982-28414052)
chr8 (559-613)||(34861191-34861245)
chr8 (547-620)||(13407437-13407510)
chr8 (547-588)||(13856508-13856549)
chr8 (551-588)||(16441830-16441867)
chr8 (548-613)||(23142937-23143002)
chr8 (478-611)||(45246481-45246613)
chr8 (577-613)||(1961403-1961439)
chr8 (428-540)||(8914768-8914880)
chr8 (427-499)||(35689595-35689667)
chr8 (546-614)||(45218629-45218695)
chr8 (553-604)||(6580950-6581001)
chr8 (561-612)||(8671078-8671129)
chr8 (547-614)||(23685131-23685198)
chr8 (552-603)||(28700564-28700615)
chr8 (543-613)||(9952866-9952936)
chr8 (567-613)||(11574164-11574210)
chr8 (476-613)||(17499234-17499368)
chr8 (553-603)||(33440624-33440674)
chr8 (547-620)||(34861300-34861371)
chr8 (569-619)||(38091488-38091538)
chr8 (547-620)||(31301109-31301182)
chr8 (425-506)||(41727424-41727505)
chr8 (559-619)||(43506533-43506590)
[»] scaffold0054 (1 HSPs)
scaffold0054 (510-619)||(30905-31014)
[»] scaffold0099 (1 HSPs)
scaffold0099 (476-584)||(27358-27468)
[»] scaffold0018 (1 HSPs)
scaffold0018 (477-611)||(27858-27991)
[»] scaffold0016 (1 HSPs)
scaffold0016 (559-613)||(204707-204761)
[»] scaffold0543 (1 HSPs)
scaffold0543 (547-588)||(9690-9731)
[»] scaffold0492 (1 HSPs)
scaffold0492 (547-588)||(11236-11277)
[»] scaffold0005 (2 HSPs)
scaffold0005 (553-613)||(296837-296897)
scaffold0005 (569-611)||(296974-297016)
[»] scaffold0204 (1 HSPs)
scaffold0204 (559-612)||(26862-26915)


Alignment Details
Target: chr3 (Bit Score: 340; Significance: 0; HSPs: 69)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 430 - 797
Target Start/End: Complemental strand, 38928190 - 38927823
Alignment:
430 ggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccattt 529  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38928190 ggaatgctagcaacactatcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccattt 38928091  T
530 ccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctttaaataattg 629  Q
    |||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
38928090 ccaaagtgtaggtcttacattgatttcacccaataaaagagtgagtgttagagaaagtgatcaaaagagagtgttgctagcattcttctttaaataattg 38927991  T
630 aacttttataaagttcaacgcattagtaatagaactctcaaattcttttaggaatttgagatgattcccatcctaaatataaatcacaacaacgttgaaa 729  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
38927990 aacttttataaagttcaacgcattagtaatagaactctcaaattcttttaggaatttgagatgattcccatcctaaatataaatcacaacaatgttgaaa 38927891  T
730 acaatgatcatgttgagaatgttcacatttattcaaactaataatatggataattgtcaagtaaacta 797  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38927890 acaataatcatgttgagaatgttcacatttattcaaactaataatatggataattgtcaagtaaacta 38927823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 156; E-Value: 2e-82
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 38927827 - 38927630
Alignment:
1 aactatacatatgagttcgctcaactttnnnnnnnnn--cattttaaacttgaaattatcactaagcaaataaaaattcaagtgcggtagagcatcaaag 98  Q
    ||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38927827 aactatacatatgagttcgctcaactttaaaaaaaaaaccattttaaacttgaaattatcactaagcaaataaaaattcaagtgcggtagagcatcaaag 38927728  T
99 tgaaggaaaaggacttcgattgtgactttaatcattggtggagaaacccactacaatgtcgtggtaaaatgcatcatattcatgtgtgattttatagt 196  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38927727 tgaaggaaaaggacttcgattgtgacttcaatcattggtggagaaacccactacaatgtcgtggtaaaatgcatcatattcatgtgtgattttatagt 38927630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 428 - 614
Target Start/End: Complemental strand, 37600313 - 37600127
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||||||||||||||||||| ||||| ||||||| |  || ||||||||||||| |||||||||||| |||| | ||||||| ||||||||||    
37600313 gaggaatgctaacaacactctcttttgagcactctctctagcacccactcttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttccat 37600214  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| |||||||||||| | |||||| |||| |||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||    
37600213 ttctaaagtgtaggtcctacattgaattcaaccaataaaagagtgggtgctagagagagtgctcaaaagagagtgttgctagcattc 37600127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 195 - 310
Target Start/End: Complemental strand, 38927231 - 38927116
Alignment:
195 gtagattaatctttttggcctttaatttcaaccaaataattttaccatttgaatattgttgaaatattaacattctttttgaagcgcataaaaattgtgt 294  Q
    ||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||    
38927231 gtagattaaactttttagcctttaatttcaaccaaataattctaccatttgaatattgttgaaatattaacattctttttggagcgcataaaaattgggt 38927132  T
295 gtgtggtgttactagt 310  Q
    ||||||||||||||||    
38927131 gtgtggtgttactagt 38927116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 427 - 614
Target Start/End: Complemental strand, 10769909 - 10769722
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcca 526  Q
    |||||||||||| ||||||||||||||| ||||| ||||||  |   | ||||||||| ||| |||||||||||| |||| | |||||||||||||||||    
10769909 tgaggaatgctagcaacactctcttttgagcactctctctatcaccgactcttttatttggtgaaatcaatgtatgtcccaccactttatatgggttcca 10769810  T
527 tttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||| |||||||||||| | ||||||||||| | ||||||||||| |||| ||||||||||| |||||||||||||||  ||||||||    
10769809 tttctaaagtgtaggtcctacattgatttcatcaaataaaagagtaagtgctagagagagtgctcaaaagagagtgttattagcattc 10769722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 432 - 614
Target Start/End: Complemental strand, 54141072 - 54140890
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    |||| |||||||||| ||||||| ||||| ||||||| | ||| || |||||||||| |||||||||||| |||| | ||||||  |||||||||||| |    
54141072 aatgttaacaacactttcttttgagcactctctctagcactcactcatttattgggtgaaatcaatgtatgtcccaccactttacgtgggttccattttc 54140973  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||  | ||||||||||| |||||||| ||||||||| |||||| |||| |||||||||||||||||||||||||    
54140972 aaagtgtaggttctacattgatttcatccaataaatgagtgagtgctagagaaagtgctcaaaagagagtgttgctagcattc 54140890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 426 - 611
Target Start/End: Original strand, 27243040 - 27243225
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    |||||| |||||| |||||||||||||||  |||| ||||||  | ||| ||||||||||| ||||||||||| || |||| | ||||||| ||||||||    
27243040 atgagggatgctagcaacactctcttttgaacactctctctaacactcactcttttattggataaaatcaatgcatgtcccaccactttatgtgggttcc 27243139  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||||||| | |   ||||||||| ||||||| | ||||||||| ||||| |||||| ||||||||||||||||||||||    
27243140 atttccaaagtgtatgacccacattgatttaacccaatgagagagtgagtattagaaagagtgttcaaaagagagtgttgctagca 27243225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 476 - 608
Target Start/End: Complemental strand, 24749045 - 24748913
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    |||||||| |||| | |||||||||| |||| | | ||||| ||||||||||||| |||||||||||| | ||||||||||| |||||||||||||||||    
24749045 tcttttatggggtgatatcaatgtatgtcccaccattttatgtgggttccatttctaaagtgtaggtcctacattgatttcatccaataaaagagtgagt 24748946  T
576 gttagagagagtgatcaaaagagagtgttgcta 608  Q
    ||||||||||||| |||||||||||||||||||    
24748945 gttagagagagtgctcaaaagagagtgttgcta 24748913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 513 - 614
Target Start/End: Complemental strand, 29775238 - 29775139
Alignment:
513 ttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    |||| |||||||||||||||||||||||||| | | |||||||||||||||||||||||  ||| ||||||||||| |||||||||||||||||||||||    
29775238 ttatgtgggttccatttccaaagtgtaggtcctaccttgatttcacccaataaaagagt--gtgctagagagagtgctcaaaagagagtgttgctagcat 29775141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 440 - 567
Target Start/End: Complemental strand, 46237217 - 46237090
Alignment:
440 caacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgta 539  Q
    ||||||||||||||| ||||| ||||||| | ||| ||||||||||| | |||||||||||| |||| | ||||||| ||||||||||||| ||| ||||    
46237217 caacactctcttttgagcactctctctagcaatcactcttttattggatgaaatcaatgtatgtcccaccactttatgtgggttccatttctaaaatgta 46237118  T
540 ggtcatgcattgatttcacccaataaaa 567  Q
    |||| | ||||||||||| |||||||||    
46237117 ggtcctacattgatttcatccaataaaa 46237090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 428 - 613
Target Start/End: Original strand, 24734702 - 24734886
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||| ||| |||||||| |||||   ||| |||||||||| ||| ||||||||||| | ||||||| |||| |||| | ||||| | ||||||| ||    
24734702 gaggaatactagcaacactcacttttcaacacaatctctagtactcactcttttattggatgaaatcaaagtatgtcccaccactttgtgtgggttcaat 24734801  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    || ||||| ||||| |   || |||||| | ||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||    
24734802 tttcaaagagtaggccca-caatgatttaaaccaataagagagtgagtattagagagagtgttcaaaagagagtgttgctagcatt 24734886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 425 - 613
Target Start/End: Complemental strand, 41452081 - 41451894
Alignment:
425 tatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttc 524  Q
    |||||||||| ||| |||||||| |||||   ||| |||||||||| ||| ||||||||||| | ||||||| |||| |||| | ||||| | |||||||    
41452081 tatgaggaatactagcaacactcacttttcaacacaatctctagtactcactcttttattggatgaaatcaaagtatgtcccaccactttgtgtgggttc 41451982  T
525 catttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
     |||| ||||| ||||  |   || |||||| | ||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||    
41451981 aattttcaaagagtagaccca-caatgatttaaaccaataagagagtgagtattagagagagtgttcaaaagagagtgttgctagcatt 41451894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 543 - 612
Target Start/End: Complemental strand, 27243116 - 27243047
Alignment:
543 catgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    ||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
27243116 catgcattgattttatccaataaaagagtgagtgttagagagagtgttcaaaagagagtgttgctagcat 27243047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 547 - 619
Target Start/End: Original strand, 37600243 - 37600315
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||||| ||||    
37600243 cattgatttcacccaataaaagagtgggtgctagagagagtgctcaaaagagagtgttgttagcattcctctt 37600315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 432 - 611
Target Start/End: Original strand, 13809083 - 13809261
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| ||||||||||||||   |||| ||||||   |||| ||||||||||| |||||||||||||| |||| | | ||||| ||||||||||||||    
13809083 aatgctagcaacactctcttttacacactctctctaac-ttcactcttttattggataaaatcaatgtatgtcccaccattttatgtgggttccatttcc 13809181  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||| || | |   ||||| ||| ||||||||| ||| ||| ||||||||| ||||  ||| | |||||||||||||||    
13809182 aaagtatatgacccacattgttttaacccaataagagaatgaatgttagagaaagtgtccaagaaagagtgttgctagca 13809261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 537 - 614
Target Start/End: Original strand, 20493548 - 20493625
Alignment:
537 gtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||| ||| ||||||||||| |||||||| ||||||||||||||||||||| | ||||| |||||||||||||||||    
20493548 gtaggacatacattgatttcatccaataaatgagtgagtgttagagagagtgttgaaaagtgagtgttgctagcattc 20493625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 478 - 611
Target Start/End: Original strand, 20791343 - 20791475
Alignment:
478 ttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgt 577  Q
    ||||||||| | |||||||||||| |||| | |||||||  | |||| ||||||||||||||| ||  ||| |||||| | ||||||| | ||||||| |    
20791343 ttttattggatgaaatcaatgtatgtcccaccactttatgcgagttctatttccaaagtgtagatcc-gcaatgatttaaaccaataagaaagtgagtat 20791441  T
578 tagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||||| ||||||||||||| ||||||||    
20791442 tagagagagtgttcaaaagagagtggtgctagca 20791475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 462 - 601
Target Start/End: Original strand, 357791 - 357928
Alignment:
462 tctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcaccca 561  Q
    ||||||| | ||| |||||||||| |  ||||||||||||  | | | ||||||| |||||||||||||||||||||||  | | ||||||||||| |||    
357791 tctctagcactcactcttttattgagggaaatcaatgtatgcctcaccactttatgtgggttccatttccaaagtgtagtacctacattgatttcatcca 357890  T
562 ataaaagagtgagtgttagagagagtgatcaaaagagagt 601  Q
    |||||| ||||||||  | |||||||| ||||||||||||    
357891 ataaaaaagtgagtg--atagagagtgttcaaaagagagt 357928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 10769838 - 10769905
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||| |||||||||||  ||| ||||||||||| |||||||||||||||||||||||||    
10769838 cattgatttcaccaaataaaagagtcggtgatagagagagtgctcaaaagagagtgttgctagcattc 10769905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 28529320 - 28529253
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| |||||||||||||||||| ||||||||||| | ||||| |||||||||||||||||    
28529320 cattgatttcatccaataaaagagtgagtgctagagagagtgttgaaaagtgagtgttgctagcattc 28529253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 424 - 605
Target Start/End: Original strand, 28529246 - 28529424
Alignment:
424 atatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggtt 523  Q
    ||||||||||||||| |||||||| |||||   |||| ||||||| | ||| ||||||||||| | |||||||||||| |||| | ||  | | ||||||    
28529246 atatgaggaatgctagcaacactcacttttcaacactctctctagcactcactcttttattggatgaaatcaatgtatgtcccaccac--tgtgtgggtt 28529343  T
524 ccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttg 605  Q
    | |||| ||||||||| | |   || |||||| | ||||||| ||||||||| |||||||| ||| ||||||||||||||||    
28529344 caattttcaaagtgta-gacccacaatgatttaaaccaataagagagtgagtattagagagggtgttcaaaagagagtgttg 28529424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 547 - 608
Target Start/End: Original strand, 46237159 - 46237220
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgcta 608  Q
    ||||||||||| ||||||||||||||| || ||||||||||| |||||||||||||||||||    
46237159 cattgatttcatccaataaaagagtgattgctagagagagtgctcaaaagagagtgttgcta 46237220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 451 - 607
Target Start/End: Complemental strand, 43657156 - 43657000
Alignment:
451 tttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcatt 550  Q
    |||| ||||| ||||||| | ||| | ||||||| | | |||||||||||| |||| | ||||||| || |||||||||||||||||||||||   ||||    
43657156 tttgagcactttctctagcactcactattttatttgatgaaatcaatgtatgtcccaccactttatgtgagttccatttccaaagtgtaggtctcacatt 43657057  T
551 gatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgct 607  Q
    | ||||||| ||||||| | | ||| ||| ||| |||  |||||| |||||||||||    
43657056 gttttcaccaaataaaaaaattagtattaaagaaagtactcaaaatagagtgttgct 43657000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 5452173 - 5452240
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||||||||| ||||| |||||||| | ||||| |||||||||||||||||    
5452173 cattgatttcatccaataaaagagtgaatgttaaagagagtgttgaaaagtgagtgttgctagcattc 5452240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 426 - 529
Target Start/End: Complemental strand, 21232707 - 21232604
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| |||||| |||||||| ||||| ||| ||| | ||| | ||||||||||| |||||||||||| | || | ||||||| ||||||||    
21232707 atgaggaatgctagcaacaccctcttttgagcactttctttagcactcatttttttattgggtgaaatcaatgtatgttccaccactttatgtgggttcc 21232608  T
526 attt 529  Q
    ||||    
21232607 attt 21232604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 426 - 613
Target Start/End: Complemental strand, 37776888 - 37776702
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| |||||||| |||||   |||| |||| || | ||| ||||||||| | | |||||||||||| |||  | ||||| | |||||||     
37776888 atgaggaatgctagcaacactcacttttcaacactttctccagcactcactcttttattagatgaaatcaatgtatgtcctaccactttgtgtgggttca 37776789  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| ||||||||| | | | || |||||| | ||| ||| ||||||||| |||||||| ||| ||| || |||||||||||||||||    
37776788 attttcaaagtgta-gacctacaatgatttaaaccactaagagagtgagtattagagagggtgttcataaaagagtgttgctagcatt 37776702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 618
Target Start/End: Complemental strand, 52951443 - 52951372
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttct 618  Q
    ||||||||||| ||||| | ||||||||| || ||||||||| | |||||||||||||||||||||||||||    
52951443 cattgatttcatccaatgatagagtgagtatttgagagagtgttaaaaagagagtgttgctagcattcttct 52951372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 547 - 605
Target Start/End: Original strand, 54141006 - 54141064
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttg 605  Q
    |||||||||||||||||||| ||||||||| ||||||||||| |||||||| |||||||    
54141006 cattgatttcacccaataaatgagtgagtgctagagagagtgctcaaaagaaagtgttg 54141064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 543 - 619
Target Start/End: Complemental strand, 46161018 - 46160944
Alignment:
543 catgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||| |||||||||| |||||||||||||||||| |  |||||||| ||||||| ||||||||||||||||| ||||    
46161018 catgtattgatttcatccaataaaagagtgagtgct--agagagtgttcaaaagtgagtgttgctagcattcctctt 46160944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 543 - 612
Target Start/End: Original strand, 50661631 - 50661700
Alignment:
543 catgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    ||||||||||||| | | ||||||||||| |||||||||||||||| | |||||||||||||||| ||||    
50661631 catgcattgattttatctaataaaagagtaagtgttagagagagtgtttaaaagagagtgttgcttgcat 50661700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 428 - 613
Target Start/End: Complemental strand, 5452243 - 5452061
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||| |||||   |||| ||| ||  ||||| ||||||||||| | |||||||||||| |||| | ||||| | ||| ||| ||    
5452243 gaggaatgctagcaacactcacttttcaacactctctttaacattcactcttttattggatgaaatcaatgtatttcccaccactttgtgtggattcaat 5452144  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    || | ||||||||  |   ||  ||||| |  |||||| |||| |||| || ||||||||| ||||||||||||||||||||||||    
5452143 tttctaagtgtagacc---caaggatttaaatcaataagagagcgagtattggagagagtgttcaaaagagagtgttgctagcatt 5452061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 21232635 - 21232702
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||||||||| | |||||| || ||| |||| ||||||||| |||||||||||||||    
21232635 cattgatttcacccaataaaaaaatgagtgctaaagaaagtgctcaaaagagggtgttgctagcattc 21232702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 550 - 613
Target Start/End: Complemental strand, 52124018 - 52123955
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||| | ||||||| | ||||||| |||||||||||| ||||||||||||||||||||||||    
52124018 tgatttaaaccaataagaaagtgagtattagagagagtgttcaaaagagagtgttgctagcatt 52123955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 476 - 578
Target Start/End: Complemental strand, 50661657 - 50661555
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||| | ||||||||||| || |||| | ||||||| ||||||||||||||||| |||| | |   ||||||||| |||||||||||||  ||||    
50661657 tcttttattagataaaatcaatgcatgtcccaccactttatgtgggttccatttccaaaatgtatgacccacattgatttaacccaataaaagaaagagt 50661558  T
576 gtt 578  Q
    |||    
50661557 gtt 50661555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 549 - 611
Target Start/End: Original strand, 52951475 - 52951537
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||| ||||| | |||||||||| ||||||||||| | ||||||||||||||||||||    
52951475 ttgatttcatccaatgagagagtgagtgctagagagagtgttaaaaagagagtgttgctagca 52951537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 476 - 613
Target Start/End: Complemental strand, 29588868 - 29588732
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| |||||||||||||| ||| |  ||||||| || |||| |||| ||||||||||  |   || |||||| |  |||||| |||||||||    
29588868 tcttttattggataaaatcaatgtatgtcctttcactttatgtgagttcaattttcaaagtgtagaccca-caatgatttaaatcaataagagagtgagt 29588770  T
576 gttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| |||||||| |||||||||| | || ||||||||    
29588769 gttatagagagtgttcaaaagagaattttactagcatt 29588732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 537 - 614
Target Start/End: Original strand, 37776806 - 37776883
Alignment:
537 gtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||| ||| ||||||||||| | |||||||||||||||| | |||| |||| | ||||| |||||||||||||||||    
37776806 gtaggacatacattgatttcatctaataaaagagtgagtgctggagaaagtgttgaaaagtgagtgttgctagcattc 37776883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 424 - 500
Target Start/End: Original strand, 37600120 - 37600196
Alignment:
424 atatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||||||| ||||||||||||||| ||||| ||||||| |  || ||||||||||| | || ||||||||    
37600120 atatgaggaatgctagcaacactctcttttgagcactctctctagcacccactcttttattggttgaattcaatgta 37600196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 541 - 613
Target Start/End: Original strand, 40715969 - 40716041
Alignment:
541 gtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||| |||| ||||||||  ||||||||||||||| ||||||||||| | ||||| ||||||||||| ||||    
40715969 gtcatacattaatttcaccatataaaagagtgagtgctagagagagtgttgaaaagtgagtgttgctaacatt 40716041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 547 - 619
Target Start/End: Complemental strand, 46576015 - 46575943
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    ||||| ||||| ||||||| |||||||||||| ||||||||| | || ||||||||||| |||||||| ||||    
46576015 cattggtttcagccaataagagagtgagtgtttgagagagtgttgaagagagagtgttgatagcattcctctt 46575943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 428 - 500
Target Start/End: Original strand, 54140887 - 54140959
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||| ||||||||||||||| ||||| ||||||| | ||| || |||||||| | |||||||||||    
54140887 gaggaatgctagcaacactctcttttgagcactttctctagcactcactcatttattggatgaaatcaatgta 54140959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 552 - 603
Target Start/End: Complemental strand, 29235709 - 29235658
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    |||||||||||||| |||||||||||||||||||||| |  |||||||||||    
29235709 atttcacccaataagagagtgagtgttagagagagtgttagaaagagagtgt 29235658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 29389126 - 29389193
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||| |  |||| ||||||||||||||| || ||||| ||||||| |||||||||||||||||    
29389126 cattgattttattcaatgaaagagtgagtgttaaagtgagtgctcaaaagtgagtgttgctagcattc 29389193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 426 - 496
Target Start/End: Original strand, 29775134 - 29775202
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaa 496  Q
    ||||||||||||| ||||||||||||||| ||||| ||||||| |  || ||||||||||||| |||||||    
29775134 atgaggaatgctagcaacactctcttttgagcactctctctagca--cactcttttattgggtgaaatcaa 29775202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 560 - 614
Target Start/End: Complemental strand, 30624685 - 30624633
Alignment:
560 caataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||||||||  || ||||||| |||||||||||||||||    
30624685 caataaaagagtgagtgttagagag--tgctcaaaagtgagtgttgctagcattc 30624633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 547 - 613
Target Start/End: Complemental strand, 13809148 - 13809083
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||| | |||||||||||||||  |||||||||||||   ||||||||||||||||||||||    
13809148 cattgattttatccaataaaagagtgaa-gttagagagagtgtgtaaaagagagtgttgctagcatt 13809083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 547 - 613
Target Start/End: Original strand, 24749023 - 24749089
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||| |||||| |||||||| |||||||||||||||| | |||||||||| | |||||| ||||    
24749023 cattgatatcaccccataaaagaatgagtgttagagagagcgttcaaaagagaatattgctaacatt 24749089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 478 - 611
Target Start/End: Original strand, 14236066 - 14236198
Alignment:
478 ttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgt 577  Q
    ||||||||| | |||||||| ||| |||| | |||||||  | |||| ||||||||||||||| ||   || | ||||   ||||||||| ||||||| |    
14236066 ttttattggatgaaatcaatatatgtcccaccactttatgcgagttctatttccaaagtgtagatcca-caataatttagaccaataaaaaagtgagtat 14236164  T
578 tagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||| |||||| |||||| |||||||||||||||    
14236165 tagaaagagtgttcaaaacagagtgttgctagca 14236198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 428 - 605
Target Start/End: Complemental strand, 20493628 - 20493452
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||| |||||   |||| ||||||  | ||| || |||||||| | |||||||||||| |||  | ||||| |  |||||| ||    
20493628 gaggaatgctagcaacactcacttttcaacactctctctaacactcactcatttattggatgaaatcaatgtatgtcctaccactttgtgggggttcaat 20493529  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttg 605  Q
     | ||||||||||  |   || |||||| | ||||||| |||||||||  ||||||||||| ||||||||||||||||    
20493528 attcaaagtgtagaccca-caatgatttaaaccaataagagagtgagtaatagagagagtgttcaaaagagagtgttg 20493452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 431 - 500
Target Start/End: Original strand, 38928006 - 38928075
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    |||||||| |||||||||||||||  |||| ||||||  | ||| ||||||||||||| |||||||||||    
38928006 gaatgctagcaacactctcttttgatcactttctctaacactcactcttttattgggtgaaatcaatgta 38928075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 551 - 588
Target Start/End: Original strand, 46156741 - 46156778
Alignment:
551 gatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||||||||||||||||||||||||||| ||||||||    
46156741 gatttcacccaataaaagagtgagtgttaaagagagtg 46156778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 428 - 620
Target Start/End: Original strand, 46575945 - 46576135
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| ||||||||||| ||   |||| |||| |  | ||| ||| ||||||| | ||| |||||||| |||| | ||||| | ||||||||||    
46575945 gaggaatgctatcaacactctctcttcaacactctctcaaacactcactctcttattggctgaaaccaatgtatgtcccaccactttttgtgggttccat 46576044  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    || |||| |||| | |   ||||||||| |||| || | ||||||||| ||| |||||||| | |||  ||||||||||||||| | ||||||    
46576045 tttcaaaatgtacgccccacattgatttaaccctattagagagtgagtattaaagagagtgttgaaa--agagtgttgctagcactattcttt 46576135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 554 - 603
Target Start/End: Original strand, 54187050 - 54187099
Alignment:
554 ttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    |||||||||||| |||||||||||||||||||||| |  |||||||||||    
54187050 ttcacccaataagagagtgagtgttagagagagtgttagaaagagagtgt 54187099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 428 - 500
Target Start/End: Original strand, 10769719 - 10769791
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    |||||||||||| |||||||||||||| ||||| ||||||| | | | ||||||||| | | |||||||||||    
10769719 gaggaatgctaataacactctcttttgagcactctctctagcacttactcttttatttgatgaaatcaatgta 10769791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 552 - 604
Target Start/End: Complemental strand, 13639464 - 13639412
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    |||||| ||||||||||||||| |||||||||||||| |  ||||||||||||    
13639464 atttcatccaataaaagagtgactgttagagagagtgttagaaagagagtgtt 13639412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 46450132 - 46450067
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| || | |||||||||||||||| ||||||| ||  ||||||| |||||||||||||||||    
46450132 cattgattccatctaataaaagagtgagtgctagagagtgt--tcaaaagtgagtgttgctagcattc 46450067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 552 - 604
Target Start/End: Original strand, 48543262 - 48543314
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    |||||||||||||| |||||||||||| ||||||||| |  ||||||||||||    
48543262 atttcacccaataagagagtgagtgttggagagagtgttagaaagagagtgtt 48543314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 526 - 612
Target Start/End: Complemental strand, 15790454 - 15790370
Alignment:
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    |||| ||||||||||| |||  | |||||| | ||||||| ||||||||| ||||||||| |  |||||| ||||||||||||||||    
15790454 attttcaaagtgtaggccat--aatgatttaaaccaataagagagtgagtattagagagattattcaaaaaagagtgttgctagcat 15790370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 20791363 - 20791296
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| ||  |||||||||||||    
20791363 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaacgttgctagcattc 20791296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 549 - 620
Target Start/End: Complemental strand, 24734770 - 24734699
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    ||||||||| |||||||||||||||||  ||||||  ||| | ||||| |||||||||||| |||| |||||    
24734770 ttgatttcatccaataaaagagtgagtactagagattgtgttgaaaagtgagtgttgctagtattcctcttt 24734699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 38928122 - 38928189
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||| ||||||||||||| ||| |  |||||| ||||  ||||||| ||||||||||||||||    
38928122 cattgattttacccaataaaagactgaatactagagatagtgcacaaaagatagtgttgctagcattc 38928189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 550 - 613
Target Start/End: Original strand, 44844100 - 44844163
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||| | ||||||||| ||||||||||||||||||||   |||||||||| |||||| ||||    
44844100 tgatttaatccaataaaaaagtgagtgttagagagagtgtcaaaaagagagtcttgctatcatt 44844163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 45515608 - 45515675
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||||| ||||||||| | ||||| ||| |||| || |||||    
45515608 cattgatttcatccaataaaatagtgagtgttggagagagtgttaaaaagtgagcgttgttaacattc 45515675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 588
Target Start/End: Original strand, 26310559 - 26310600
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||||||||| ||||||||||||| |||| |||||||||||    
26310559 cattgatttcatccaataaaagagtaagtgctagagagagtg 26310600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 559 - 620
Target Start/End: Original strand, 30624746 - 30624807
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    ||||||| ||||| |||||||||||  ||| |||||| |||||||||||  |||||||||||    
30624746 ccaataagagagtaagtgttagagatggtgctcaaaaaagagtgttgctgacattcttcttt 30624807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 480 - 585
Target Start/End: Original strand, 37926580 - 37926685
Alignment:
480 ttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgtta 579  Q
    ||||| ||| |||||||||||  |||  ||||||||| ||||  |||||| |||||||  || | | ||||||||| |||||| || ||||| |||||||    
37926580 ttattaggtgaaatcaatgtaggtcctactactttatgtgggacccattttcaaagtgcgggacctacattgatttaacccaacaagagagtaagtgtta 37926679  T
580 gagaga 585  Q
    ||||||    
37926680 gagaga 37926685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 614
Target Start/End: Original strand, 41452010 - 41452075
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||| |||||||||||||||||  ||||||  ||| | ||||| |||||||||||| ||||    
41452010 ttgatttcatccaataaaagagtgagtactagagattgtgttgaaaagtgagtgttgctagtattc 41452075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 596
Target Start/End: Original strand, 41707552 - 41707601
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaag 596  Q
    ||||||||| | ||||| | |||||||||||||||||||||| |||||||    
41707552 cattgattttatccaatgagagagtgagtgttagagagagtgctcaaaag 41707601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 613
Target Start/End: Original strand, 50320541 - 50320594
Alignment:
560 caataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||| ||||||||||||||||||||||| |  ||||| |||||| ||||||||    
50320541 caatagaagagtgagtgttagagagagtgctagaaagaaagtgttcctagcatt 50320594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 120; Significance: 6e-61; HSPs: 75)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 6e-61
Query Start/End: Original strand, 426 - 621
Target Start/End: Original strand, 11430436 - 11430630
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||||||||||||||||||| ||||| | ||||| | ||| ||||||||||||| |||||||||||| |||| | ||||||| ||||||||    
11430436 atgaggaatgctaacaacactctcttttgagcactctttctagcactcactcttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttcc 11430535  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttta 621  Q
    |||||||||||||||||| | |||||| |||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||    
11430536 atttccaaagtgtaggtcctacattgaattca-ccaataaaagagtgagtgctagagagagtgctcaaaagagagtgttgctagcattcctcttta 11430630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 426 - 612
Target Start/End: Original strand, 11135734 - 11135920
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| ||||||||||||||| ||||| ||||||| | ||| | ||||||||||| |||||||||||| |||| | ||||||| ||||||||    
11135734 atgaggaatgctagcaacactctcttttgagcactctctctagcactcactattttattgggtgaaatcaatgtatgtcccaccactttatgtgggttcc 11135833  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    |||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||    
11135834 atttccaaagtgtaggtcctacattgatttcacccaataaaagagtgagtgctagagagagtcctcaaaagagagtgttgctagcat 11135920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 426 - 621
Target Start/End: Complemental strand, 32848768 - 32848573
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    |||||||||||||||||||||||||||||  |||| ||||||| | ||| ||||||||||||| |||||| ||||| |||| | ||||||| ||| ||||    
32848768 atgaggaatgctaacaacactctcttttgaacactctctctagcactcactcttttattgggtgaaatcattgtatgtcccaccactttatgtggattcc 32848669  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttta 621  Q
    |||| ||||||||||||| | |||||| |||| ||||||||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||||    
32848668 attttcaaagtgtaggtcctacattgaattcaaccaataaaagagtaagtgctagagaaagtgctcaaaagagagtgttgctagcagtcctcttta 32848573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 432 - 614
Target Start/End: Complemental strand, 41095788 - 41095606
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| ||||||||||||||| ||||| ||||||| | ||| || |||||||||| |||||||||||| ||||   ||| | | |||||||||||| |    
41095788 aatgctagcaacactctcttttgagcactctctctagcactcactcatttattgggtgaaatcaatgtatgtcccatcactctgtgtgggttccattttc 41095689  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||| | ||||||||||||||||||||  |||||||| ||||||||||| |||||||||||||||||||||||||    
41095688 aaagtgtaggtcctacattgatttcacccaataaataagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 41095606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 428 - 614
Target Start/End: Complemental strand, 14094184 - 14093998
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| | ||| | |||||||  |||| |||| || | ||| | ||||||||||| |||||||||||| |||| | ||||||| ||||||||||    
14094184 gaggaatgctagcgacattatcttttgaacactctctccagcactcacttttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttccat 14094085  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||| | |||||||||||| |||| ||| ||||||||||| | |||||| ||||||||||||||||||| |||||    
14094084 ttccaaagtgtaggtcctacattgatttcactcaatcaaaaagtgagtgttacaaagagtgttcaaaagagagtgttgctaacattc 14093998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 431 - 576
Target Start/End: Original strand, 41917995 - 41918140
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttc 530  Q
    |||||||| ||||||||||||||| ||||  ||||||| | ||| ||||||||||||| |||||||||||| |||| | ||||||| ||| ||||||||     
41917995 gaatgctagcaacactctcttttgagcaccctctctagcactcactcttttattgggtgaaatcaatgtatgtcccaccactttatgtggattccatttt 41918094  T
531 caaagtgtaggtcatgcattgatttcacccaataaaagagtgagtg 576  Q
    ||||||||||||| | ||||||||| ||||||||||||||||||||    
41918095 caaagtgtaggtcctacattgattttacccaataaaagagtgagtg 41918140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 476 - 614
Target Start/End: Complemental strand, 13388474 - 13388334
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatg--ggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtga 573  Q
    ||||||||||||| |||||||||||| || | | ||||||||||  |||| ||||| ||||||||||||  | ||||||||||| ||||||||| |||||    
13388474 tcttttattgggtgaaatcaatgtatgtctcaccactttatatgtgggtttcattttcaaagtgtaggtactacattgatttcatccaataaaaaagtga 13388375  T
574 gtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||  |||||||||||||||||||||||||    
13388374 gtgttagagagagtattcaaaagagagtgttgctagcattc 13388334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 476 - 619
Target Start/End: Original strand, 29418526 - 29418670
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaat-aaaagagtgag 574  Q
    ||||||||||| |||||| |||||||||| | | ||||||| || |||| ||||||||||||||| || | ||||||||||||||||| |||| ||||||    
29418526 tcttttattggataaaattaatgtatatctcaccactttatgtgagttctatttccaaagtgtagatcctacattgatttcacccaataaaaaaagtgag 29418625  T
575 tgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    || || ||||||||||||||||||| |||||||||||||| ||||    
29418626 tgatatagagagtgatcaaaagagactgttgctagcattcctctt 29418670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 476 - 613
Target Start/End: Complemental strand, 50773246 - 50773109
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| |||||||||| ||| | || | ||||||| ||||||||||||||||| | |||||| | |||| |||| ||||||||||||| |||||    
50773246 tcttttattggataaaatcaatatatgttccaccactttatgtgggttccatttccaaaatataggtcctacattaattttacccaataaaagaatgagt 50773147  T
576 gttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    | ||||||||||| |||||||||||| |||||||||||    
50773146 gctagagagagtgttcaaaagagagtattgctagcatt 50773109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 432 - 611
Target Start/End: Complemental strand, 13114849 - 13114670
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| | |||||||||||||  |||| ||||||  | ||| ||||||||| | |||||||||| ||| |||| | ||||||||||| ||||||||||    
13114849 aatgctagcgacactctcttttggacactctctctaacactcactcttttattagataaaatcaatatatgtcccaccactttatatggattccatttcc 13114750  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||| ||||   |   ||||||||| ||||||| | | ||||||||||||||||||||  |||||||||||||||||||||    
13114749 aaaatgtataacccacattgatttaacccaatgagatagtgagtgttagagagagtgtccaaaagagagtgttgctagca 13114670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 547 - 619
Target Start/End: Complemental strand, 41918062 - 41917990
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||    
41918062 cattgatttcacccaataaaagagtgagtgctagagagggtgctcaaaagagagtgttgctagcattcttctt 41917990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 490 - 583
Target Start/End: Complemental strand, 24436588 - 24436495
Alignment:
490 aaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagaga 583  Q
    ||||||||||||||||| | ||||||| ||||||| |||| |||||||| |||| | |||||||||||||||||||||||| ||||||||||||    
24436588 aaatcaatgtatatcccaccactttatgtgggttctattttcaaagtgtgggtcctacattgatttcacccaataaaagagggagtgttagaga 24436495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 478 - 619
Target Start/End: Original strand, 43832316 - 43832457
Alignment:
478 ttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgt 577  Q
    |||||||| |||| |||||| |||||| |  |||||||| |||||| |||||||||||||||| || | |||||||||| || ||||||||||||| ||     
43832316 ttttattgagtaagatcaatatatatctcattactttatgtgggtttcatttccaaagtgtagatcctacattgatttcgccgaataaaagagtgaatgc 43832415  T
578 tagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||| |||||| |||||||||||| ||| || ||||| ||||    
43832416 tagaaagagtgttcaaaagagagttttgatatcattcctctt 43832457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 11135806 - 11135739
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||    
11135806 cattgatttcacccaataaaatagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 11135739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 476 - 611
Target Start/End: Complemental strand, 50425001 - 50424866
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| ||||||||||  ||| ||| | ||||||| |  ||||||||||||||||||| | |   ||||||||| ||||||||||| ||||| |    
50425001 tcttttattggataaaatcaatccataccccaccactttatgtaagttccatttccaaagtgtatgacccacattgatttaacccaataaaaaagtgaat 50424902  T
576 gttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||||||   ||||||||||||||||||||    
50424901 gttagagagagtgcctaaaagagagtgttgctagca 50424866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 547 - 613
Target Start/End: Original strand, 41095722 - 41095788
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||    
41095722 cattgatttcacccaataaatgagtgagtgctagagagagtgctcaaaagagagtgttgctagcatt 41095788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 488 - 619
Target Start/End: Complemental strand, 30679034 - 30678904
Alignment:
488 taaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtagg-tcatgcattgatttcacccaataaaagagtgagtgttagagagag 586  Q
    |||||||||||||| |||| | ||||| | ||||||| |||| ||||||||||  |||  || |||||| | ||||||| ||||||||||||||||||||    
30679034 taaaatcaatgtatgtcccaccactttgtgtgggttcaattttcaaagtgtagactca--caatgatttaagccaataagagagtgagtgttagagagag 30678937  T
587 tgatcaaaagagagtgttgctagcattcttctt 619  Q
    || |||||| |||||||||||||||||| ||||    
30678936 tgctcaaaaaagagtgttgctagcattcctctt 30678904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 476 - 603
Target Start/End: Original strand, 15660938 - 15661063
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| ||||||||||| || |||| | |||||||  |||||  ||||||||| |||| | ||  ||||||||| ||||||||| |||||||||    
15660938 tcttttattggataaaatcaatgcatgtcccaccactttatgcgggttttatttccaaaatgtatgaca--cattgatttaacccaataatagagtgagt 15661035  T
576 gttagagagagtgatcaaaagagagtgt 603  Q
    |||||||||||||  |||||||||||||    
15661036 gttagagagagtgtccaaaagagagtgt 15661063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 550 - 614
Target Start/End: Original strand, 32848699 - 32848763
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||    
32848699 tgatttcacccaataaaagagtgagtgctagagagagtgttcaaaagagagtgttgttagcattc 32848763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 11430508 - 11430441
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||| ||||||||    
11430508 cattgatttcacccaataaaagagtgagtgctagaaagagtgctcaaaagagagtgttgttagcattc 11430441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 431 - 611
Target Start/End: Complemental strand, 19101781 - 19101602
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttc 530  Q
    |||||||| ||||| || ||||||  |||| ||| ||| | ||| | ||||||||| | |||||||||||| |||| | |||||||  | |||| ||||     
19101781 gaatgctagcaacattcacttttgcacactctctttagcactcactattttattggatgaaatcaatgtatgtcccaccactttatgcgagttctatttt 19101682  T
531 caaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||| || |||| |||||| | ||||||| | ||||||| |||||||||||| ||||||||||||  ||||||||    
19101681 caaagtgtagatc-tgcaatgatttaaaccaataagaaagtgagtattagagagagtgttcaaaagagagtagtgctagca 19101602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 448 - 614
Target Start/End: Original strand, 28109885 - 28110050
Alignment:
448 tcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgc 547  Q
    ||||||| ||||| ||||||| | ||| | ||||||||||| ||||||||| || | || | | ||||| ||||||||||||| ||||||||| || |      
28109885 tcttttgagcactttctctagcactcacttttttattgggtgaaatcaatgcatgttccaccattttatgtgggttccatttc-aaagtgtagatcctag 28109983  T
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    | |||||||| ||||||||| ||||||| ||||||| |||  | ||||||||||||| ||| |||||    
28109984 aatgatttcatccaataaaaaagtgagtattagagaaagtacttaaaagagagtgttcctaacattc 28110050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 427 - 529
Target Start/End: Complemental strand, 43851219 - 43851117
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcca 526  Q
    ||||||||| || ||||||||||||||  || |  ||||||||| ||| || |||||||||| |||||||||||| |||| | |||||||||||||||||    
43851219 tgaggaatgttagcaacactctcttttaagcgcactctctagtactcactcatttattgggtgaaatcaatgtatgtcccaccactttatatgggttcca 43851120  T
527 ttt 529  Q
    |||    
43851119 ttt 43851117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 547 - 611
Target Start/End: Original strand, 4578690 - 4578752
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||||||||||||||||||||||||||  |||||||| | ||||||||||||||||||||    
4578690 cattgatttcacccaataaaagagtgagtgtt--agagagtgttgaaaagagagtgttgctagca 4578752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 537 - 614
Target Start/End: Complemental strand, 9165379 - 9165302
Alignment:
537 gtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||| ||| ||||||||||||||||||||||||||||||  ||| |||||| |||||||||||||| | ||||||||    
9165379 gtaggacatacattgatttcacccaataaaagagtgagtgcaagatagagtggtcaaaagagagtgtggatagcattc 9165302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 547 - 620
Target Start/End: Complemental strand, 44739185 - 44739112
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    |||| ||||||| ||| ||||||||||||| ||||||||||| ||||||||||||||||||| ||||| |||||    
44739185 cattaatttcactcaagaaaagagtgagtgctagagagagtgttcaaaagagagtgttgctaacattcctcttt 44739112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 548 - 620
Target Start/End: Complemental strand, 25543406 - 25543334
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    |||||||||| | ||||||||||| |||||||||||||||| | ||||| ||||||||||||||||| |||||    
25543406 attgatttcatcaaataaaagagtaagtgttagagagagtgtttaaaagtgagtgttgctagcattcctcttt 25543334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 457 - 613
Target Start/End: Complemental strand, 41948300 - 41948145
Alignment:
457 cactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttc 556  Q
    |||||| |||| || ||| ||||||||||| |||||||||||||||| |  | ||||| | | ||||| |||| |||||||||  ||   || ||||||     
41948300 cactatttctaatactcactcttttattggataaaatcaatgtatattctaccactttgtgttggttcaattttcaaagtgtaaatcca-caatgattta 41948202  T
557 acccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |  |||||| |||||||||||||||||||||| |||||||||| | |||||||||||    
41948201 aatcaataagagagtgagtgttagagagagtgttcaaaagagaatattgctagcatt 41948145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 548 - 613
Target Start/End: Original strand, 13114784 - 13114849
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||| | | ||||||||||||||||||||||||||||  ||||||||||||| |||||||||    
13114784 attgattttatctaataaaagagtgagtgttagagagagtgtccaaaagagagtgtcgctagcatt 13114849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 518 - 613
Target Start/End: Original strand, 8899101 - 8899195
Alignment:
518 tgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||| |||| |||||||||||||   || | |||| | ||||||| ||||||||| |||||||||||| |||||||||| |||||||||||||    
8899101 tgggttcaattttcaaagtgtaggtcca-caataatttaaaccaataagagagtgagtattagagagagtgttcaaaagagattgttgctagcatt 8899195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 14094114 - 14094181
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||||||||| |||||||| | ||||||||| |||||||| | ||| ||||||||||    
14094114 cattgatttcacccaataaaaaagtgagtgctggagagagtgttcaaaagataatgtcgctagcattc 14094181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 26980375 - 26980442
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||| ||||||||| |||||||||||| | ||||| |||||||| ||||||||    
26980375 cattgatttcatccaataatagagtgagtattagagagagtgttgaaaagtgagtgttgttagcattc 26980442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 428 - 543
Target Start/End: Original strand, 44739115 - 44739230
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    |||||||| || |||||||||||||||  |||| ||||||| | ||| |||||| ||| || |||| ||||||| |||| | ||||||| || |||  ||    
44739115 gaggaatgttagcaacactctcttttgaacactctctctagcactcactcttttcttgagtgaaattaatgtatgtcccaccactttatgtgagttgtat 44739214  T
528 ttccaaagtgtaggtc 543  Q
    ||||||||||||||||    
44739215 ttccaaagtgtaggtc 44739230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 548 - 614
Target Start/End: Original strand, 6133738 - 6133804
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||| |||||||||| ||||||| |||||||| || | ||||| |||||||||||||||||    
6133738 attgatttcatccaataaaagggtgagtgctagagagattgttgaaaagtgagtgttgctagcattc 6133804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 426 - 500
Target Start/End: Complemental strand, 11135927 - 11135853
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    |||||| |||||| ||||||||||||||| | ||| ||||||| | ||| ||||||||||||| |||||||||||    
11135927 atgagggatgctagcaacactctcttttgaggactctctctagcactcactcttttattgggtgaaatcaatgta 11135853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 543 - 597
Target Start/End: Complemental strand, 28109939 - 28109885
Alignment:
543 catgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaaga 597  Q
    ||||||||||||||||||||||||| |||||||| |||||| |||| ||||||||    
28109939 catgcattgatttcacccaataaaaaagtgagtgctagagaaagtgctcaaaaga 28109885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 614
Target Start/End: Original strand, 39039470 - 39039535
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||| |||||||||||||||||| || | |||||| | ||||| |||||||||||||||||    
39039470 ttgatttcatccaataaaagagtgagtgctaaaaagagtgttgaaaagtgagtgttgctagcattc 39039535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 561 - 617
Target Start/End: Original strand, 3872760 - 3872816
Alignment:
561 aataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttc 617  Q
    |||| ||||||||||| ||||||||||| | ||||| ||||||||||||||||||||    
3872760 aatagaagagtgagtgctagagagagtgttgaaaagtgagtgttgctagcattcttc 3872816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 552 - 588
Target Start/End: Complemental strand, 24886099 - 24886063
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtg 588  Q
    |||||||||||||||||||||||||||||||||||||    
24886099 atttcacccaataaaagagtgagtgttagagagagtg 24886063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 428 - 612
Target Start/End: Complemental strand, 26980445 - 26980262
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    |||||||||||||||||||| |||||   |||| |||||| || ||| ||| ||||||| | |||||||||||| |||| | | ||| | || |||| ||    
26980445 gaggaatgctaacaacactcacttttcaacactctctctaatactcactctattattggatgaaatcaatgtatgtcccaccattttgtgtgagttcaat 26980346  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcat 612  Q
    || |||| | ||  ||   || |||||| |  |||||| ||||||||| ||| |||||||| | |||||||||||||||||||||    
26980345 tttcaaaatatacatcca-caatgatttaaatcaataagagagtgagtattatagagagtgttgaaaagagagtgttgctagcat 26980262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 428 - 500
Target Start/End: Original strand, 41095603 - 41095675
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||| ||||||||||||||| ||||| ||||||| | ||| |  |||||||||| |||||||||||    
41095603 gaggaatgctagcaacactctcttttgagcactctctctagcactcacttatttattgggtgaaatcaatgta 41095675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 548 - 608
Target Start/End: Original strand, 50773225 - 50773285
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgcta 608  Q
    |||||||| | ||||||||||||||||||||||||||||   |||||| ||||||||||||    
50773225 attgattttatccaataaaagagtgagtgttagagagagcagtcaaaatagagtgttgcta 50773285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 19101714 - 19101781
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||||||||||||    
19101714 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgctagcattc 19101781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 431 - 611
Target Start/End: Original strand, 22540368 - 22540543
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttc 530  Q
    |||||||| ||||| || ||||||  |||| ||| ||| | ||| | ||||||||| | |||||||||||| |||| | |||||||  | |||| |||||    
22540368 gaatgctagcaacattcacttttgcacactctctttagcactcactattttattggatgaaatcaatgtatgtcccaccactttatgcgagttctatttc 22540467  T
531 caaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||| ||  ||| |||||| | ||||||    ||| ||| ||| |||||||| ||||||||||||| ||||||||    
22540468 caaagtgtagatc-cgcaatgatttaaaccaata----agttagtattaaagagagtgttcaaaagagagtggtgctagca 22540543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 22540435 - 22540368
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||||||||||||    
22540435 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgctagcattc 22540368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 43851148 - 43851215
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||| ||||||||  ||||||| | | | ||||||||||||||||| |||||    
43851148 cattgatttcacccaataaatgagtgagtactagagagtgcgcttaaaagagagtgttgctaacattc 43851215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 547 - 613
Target Start/End: Complemental strand, 18157105 - 18157039
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| |||||| ||||||||| |||| ||||||||||||||| | ||||||||||||  ||||||||    
18157105 cattaatttcatccaataaaaaagtgggtgttagagagagtgttgaaaagagagtgtccctagcatt 18157039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 553 - 603
Target Start/End: Complemental strand, 28274847 - 28274797
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    ||||| ||||||| |||||||||||||||||||||| | ||||||||||||    
28274847 tttcatccaataagagagtgagtgttagagagagtgttgaaaagagagtgt 28274797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 476 - 588
Target Start/End: Complemental strand, 4578712 - 4578599
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc-atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgag 574  Q
    ||||||||||||| |||||||||||  |||| | |||||||  ||| ||| |||||||||||||||| |   |||||||||||||||| || |||| | |    
4578712 tcttttattgggtgaaatcaatgtaggtcccaccactttatgcggggtcccatttccaaagtgtaggacccacattgatttcacccaaaaagagagcggg 4578613  T
575 tgttagagagagtg 588  Q
    |||||  |||||||    
4578612 tgttacggagagtg 4578599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 577 - 614
Target Start/End: Original strand, 13889289 - 13889326
Alignment:
577 ttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||| |||||||||||||||||||||||||    
13889289 ttagagagagtgttcaaaagagagtgttgctagcattc 13889326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 428 - 500
Target Start/End: Complemental strand, 11430626 - 11430555
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||| ||||||||||||||| ||||| ||||||| | ||| ||||||||| ||| || ||||||||    
11430626 gaggaatgctagcaacactctcttttgagcactctctctagcactcactcttttatt-ggtgaattcaatgta 11430555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 550 - 614
Target Start/End: Original strand, 21466687 - 21466751
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||||||||||||    
21466687 tgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgctagcattc 21466751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 553 - 613
Target Start/End: Original strand, 24886159 - 24886219
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||||  |||||||||||||||||||||| |  ||||||||||||  |||||||    
24886159 tttcacccaataggagagtgagtgttagagagagtgctagaaagagagtgttcttagcatt 24886219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 553 - 613
Target Start/End: Original strand, 29068200 - 29068260
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||| ||||||  |||||||||||||||||||||| |  |||||||||||| ||||||||    
29068200 tttcatccaataggagagtgagtgttagagagagtgctagaaagagagtgttcctagcatt 29068260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 39019636 - 39019575
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||      ||||||| ||||||||| | |||||||||||||||||||||||    
39019636 cattgatttcacccaataa------gagtgtttgagagagtgttgaaaagagagtgttgctagcattc 39019575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 567 - 611
Target Start/End: Original strand, 39019702 - 39019746
Alignment:
567 agagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||| ||||||| |||| ||||||||||||||||||||||    
39019702 agagtgagtattagagaaagtgttcaaaagagagtgttgctagca 39019746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 549 - 585
Target Start/End: Complemental strand, 50308822 - 50308786
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagaga 585  Q
    |||||||||||||||||||||||||||| ||||||||    
50308822 ttgatttcacccaataaaagagtgagtgctagagaga 50308786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 432 - 500
Target Start/End: Original strand, 50773109 - 50773177
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||| ||| |||||||||||  |||| ||||||| | ||| |||||||||||||||||| ||||||    
50773109 aatgctagcaatactctcttttgaacactctctctagcactcattcttttattgggtaaaattaatgta 50773177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 15523277 - 15523210
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||| ||||||||    
15523277 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgatagcattc 15523210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 15531271 - 15531204
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||| ||||||||    
15531271 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgatagcattc 15531204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 560 - 619
Target Start/End: Complemental strand, 16948581 - 16948522
Alignment:
560 caataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||| ||||||||| ||||||| | || |||| |||||||||||||||||||| ||||    
16948581 caataagagagtgagtattagagaaaatgttcaacagagagtgttgctagcattcctctt 16948522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 553 - 588
Target Start/End: Complemental strand, 19078972 - 19078937
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||||||||||| ||||||||||||||||||||||    
19078972 tttcacccaataagagagtgagtgttagagagagtg 19078937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 553 - 588
Target Start/End: Complemental strand, 19126860 - 19126825
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||||||||||| ||||||||||||||||||||||    
19126860 tttcacccaataagagagtgagtgttagagagagtg 19126825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 552 - 603
Target Start/End: Complemental strand, 29068140 - 29068089
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    |||||||||||||||| ||||||||||||||| |||| |  |||||||||||    
29068140 atttcacccaataaaatagtgagtgttagagaaagtgttagaaagagagtgt 29068089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 550 - 613
Target Start/End: Complemental strand, 39974262 - 39974199
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||| | ||||||| ||||||||| ||||| ||| || |||||||||||||||| |||||||    
39974262 tgatttaaaccaataagagagtgagtattagaaagaatgttcaaaagagagtgttgttagcatt 39974199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 587
Target Start/End: Original strand, 50424980 - 50425019
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagt 587  Q
    |||||||| | |||||||||||||||||||||||||||||    
50424980 attgattttatccaataaaagagtgagtgttagagagagt 50425019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 560 - 614
Target Start/End: Complemental strand, 931428 - 931374
Alignment:
560 caataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||| ||||||| || | | ||||| |||||||||||||||||    
931428 caataaaagagtgagtattagagatagagttgaaaagtgagtgttgctagcattc 931374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 559 - 613
Target Start/End: Complemental strand, 6133678 - 6133624
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||| ||||||||| ||||||||  || ||||||||||||||||||| ||||    
6133678 ccaataagagagtgagtattagagaggatgttcaaaagagagtgttgctaacatt 6133624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 550 - 611
Target Start/End: Original strand, 15928673 - 15928732
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||| | ||||||||||||||||| ||  |||||||| |||||||||||||||| |||||    
15928673 tgatttaaaccaataaaagagtgagtatt--agagagtgttcaaaagagagtgttggtagca 15928732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 550 - 604
Target Start/End: Original strand, 25543457 - 25543511
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    |||||| | ||||||| | ||||||| |||||||||||| |||||||||||||||    
25543457 tgatttaaaccaataagatagtgagtattagagagagtgttcaaaagagagtgtt 25543511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 563 - 613
Target Start/End: Complemental strand, 29663625 - 29663575
Alignment:
563 taaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||| ||||||||| |||| ||||||| ||||||| ||||||||    
29663625 taaaagagtgaatgttagagaaagtgttcaaaagtgagtgtttctagcatt 29663575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 428 - 501
Target Start/End: Original strand, 9165299 - 9165372
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtat 501  Q
    ||||||||||| | |||||||||||||  |||| | ||| | | ||| ||||||||||||| ||||||||||||    
9165299 gaggaatgctatccacactctcttttgaccactctatcttgcactcactcttttattgggtgaaatcaatgtat 9165372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 550 - 611
Target Start/End: Complemental strand, 12767390 - 12767329
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||| | ||||||||||||||||| |||||||| ||  |||||||||| | |||||||||    
12767390 tgatttaaaccaataaaagagtgagtattagagagggttttcaaaagagatttttgctagca 12767329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 576
Target Start/End: Original strand, 13388452 - 13388481
Alignment:
547 cattgatttcacccaataaaagagtgagtg 576  Q
    ||||||||||||||||||||||||||||||    
13388452 cattgatttcacccaataaaagagtgagtg 13388481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 434 - 499
Target Start/End: Original strand, 50424866 - 50424931
Alignment:
434 tgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgt 499  Q
    ||||| ||||||||||||||  ||||| ||||||  ||||| | ||||||||||| ||||||||||    
50424866 tgctagcaacactctcttttaggcactctctctaacattcacttttttattgggttaaatcaatgt 50424931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 119; Significance: 2e-60; HSPs: 41)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 428 - 614
Target Start/End: Complemental strand, 19090398 - 19090212
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||||||||||||||||||| ||||| ||||||| |  || ||||||||||||| |||||||||||| |||| | ||||||| ||||||||||    
19090398 gaggaatgctaacaacactctcttttgagcactctctctagcacccactcttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttccat 19090299  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||| | |||||| |||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
19090298 ttccaaagtgtaggtcctacattgaattcaaccaataaaagagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 19090212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 434 - 618
Target Start/End: Complemental strand, 35128900 - 35128720
Alignment:
434 tgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaa 533  Q
    ||||| |||||||||||||||  |||| ||||||| | ||| |||||||||||||||||||||||||| |||| | ||||||| |||||||||||| |||    
35128900 tgctagcaacactctcttttgaacactctctctagcagtcactcttttattgggtaaaatcaatgtatgtcccaccactttatgtgggttccattttcaa 35128801  T
534 agtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttct 618  Q
    |||||||||| | ||||||||||||||||||||| | ||||||||||||||     |||||||||||||||| ||||||||||||    
35128800 agtgtaggtcctacattgatttcacccaataaaaaaatgagtgttagagagc----tcaaaagagagtgttgttagcattcttct 35128720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 428 - 608
Target Start/End: Original strand, 10060856 - 10061036
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||||||||||  |||| | | ||  | ||| |||||||||  || |||||||||||| |||| | ||||||| ||||||||||    
10060856 gaggaatgctagcaacactctcttttgaacactctttataacaatcactcttttattatgtgaaatcaatgtatgtcccgccactttatgtgggttccat 10060955  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgcta 608  Q
    || ||||||||||||| | ||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||    
10060956 tttcaaagtgtaggtcctacattgatctcacccaataaaaaagtgagtgttagagagagtgctcaaaagagagtgttgcta 10061036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 441 - 614
Target Start/End: Complemental strand, 19737605 - 19737432
Alignment:
441 aacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtag 540  Q
    |||||| | ||||| ||||| ||||||| | ||| ||||| ||||||| ||||||||||||||||    ||||||| |||||| ||||||||||||||||    
19737605 aacactttattttgagcactctctctagcactcactctttaattgggtgaaatcaatgtatatcctatcactttatgtgggtttcatttccaaagtgtag 19737506  T
541 gtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| | ||||||||| | |||||||||||||||||| |||||||| || |||||||||||||||||||||||||    
19737505 gtcctacattgatttgagccaataaaagagtgagtgatagagagaatgttcaaaagagagtgttgctagcattc 19737432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 428 - 617
Target Start/End: Complemental strand, 6531481 - 6531296
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| ||||||||||||||| | ||| |||| || | ||| ||||||||||||| |||||||||||| |||| ||||||||| || |||||||    
6531481 gaggaatgctagcaacactctcttttgaggactctctccagcactcactcttttattgggtgaaatcaatgtatgtcccactactttatgtgagttccat 6531382  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttc 617  Q
    |||| ||||||||||| | |||| ||||||||     |||||||||||| |||||||| |  | |||||||||||||||||||| |||||    
6531381 ttccgaagtgtaggtcctacattaatttcacc----taaagagtgagtgctagagagaatacttaaaagagagtgttgctagcactcttc 6531296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 428 - 588
Target Start/End: Original strand, 373396 - 373556
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||||||||| ||| ||||| ||||| ||||||| |  || | |||||||||||||||||||||||| ||||   ||||||| ||| ||||||    
373396 gaggaatgctaacaacattcttttttgagcactctctctagcacccacttttttattgggtaaaatcaatgtatgtcccagcactttatgtggattccat 373495  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    || ||||| ||||||| | ||||||||| | ||||||||| ||| ||||||||||||||||    
373496 tttcaaagggtaggtcctacattgattttatccaataaaatagtaagtgttagagagagtg 373556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 457 - 613
Target Start/End: Original strand, 4595768 - 4595922
Alignment:
457 cactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttc 556  Q
    |||| ||||||| | ||| |||||||||| || |||||||||||| || | | ||||| |||||||||||||| ||||||||| ||| | |||| |||||    
4595768 cactctctctagcactcactcttttattgagtgaaatcaatgtatgtctcaccactttttatgggttccattttcaaagtgtaagtcctacattaatttc 4595867  T
557 acccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||| || ||||||||||||| |  | |||||  ||||||||||||||||||||||||    
4595868 accaaagaaaagagtgagtgct--aaagagttctcaaaagagagtgttgctagcatt 4595922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 431 - 611
Target Start/End: Original strand, 21987292 - 21987471
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttc 530  Q
    |||||||||||||| || ||||||  |||| ||| ||| | ||| | ||||||||| | ||||||||||||||||| | |||||||  | |||| |||||    
21987292 gaatgctaacaacattcacttttgcacactctctttagcactcactattttattggatgaaatcaatgtatatcccaccactttatgcgagttctatttc 21987391  T
531 caaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||| ||  ||| |||||| | ||||||| | ||||||| |||||||||||| ||||||||| ||| ||||||||    
21987392 caaagtgtagatc-cgcaatgatttaaaccaataagaaagtgagtattagagagagtgttcaaaagagggtggtgctagca 21987471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 547 - 619
Target Start/End: Original strand, 19090328 - 19090400
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||||| ||||    
19090328 cattgatttcacccaataaaagagtgggtgctagagagagtgctcaaaagagagtgttgttagcattcctctt 19090400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 6531411 - 6531478
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||||||||||||| | ||||||||  |||||||||||||||||||||||||    
6531411 cattgatttcacccaataaaagagtgagtgctggagagagtcctcaaaagagagtgttgctagcattc 6531478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 476 - 612
Target Start/End: Original strand, 34905381 - 34905516
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| | |||||||||||| |||| | ||||| | ||||||| |||| ||||||||||  |   || |||||| | ||||||| |||||||||    
34905381 tcttttattggatgaaatcaatgtatgtcccaccactttgtttgggttcaattttcaaagtgtagaccca-caatgatttaaaccaataagagagtgagt 34905479  T
576 gttagagagagtgatcaaaagagagtgttgctagcat 612  Q
     |||||||| ||| |||||||||||||||||||||||    
34905480 attagagagggtgttcaaaagagagtgttgctagcat 34905516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 547 - 611
Target Start/End: Original strand, 35128836 - 35128900
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||| ||||||||||||||||| || ||||||||||| ||||||||||||||||||||||    
35128836 cattgattttacccaataaaagagtgactgctagagagagtgttcaaaagagagtgttgctagca 35128900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 547 - 613
Target Start/End: Complemental strand, 34905403 - 34905337
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||| |||||||||||||||||||||||||||||| | ||||  ||||||||||||||||    
34905403 cattgatttcatccaataaaagagtgagtgttagagagagtgttgaaaaatgagtgttgctagcatt 34905337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 547 - 620
Target Start/End: Complemental strand, 10060926 - 10060853
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    ||||||||||||  ||||||||||||| ||||| | |||||| ||||||||||||||||||||||||| |||||    
10060926 cattgatttcacataataaaagagtgattgttataaagagtgttcaaaagagagtgttgctagcattcctcttt 10060853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 440 - 616
Target Start/End: Complemental strand, 12794985 - 12794809
Alignment:
440 caacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgta 539  Q
    |||||||||||||||  |||| ||||||  ||| | |  ||||||  || |||| |||||||||||| | ||||||| || ||| ||||| |||| ||||    
12794985 caacactctcttttgaacactctctctaacatttatttatttatttagtgaaattaatgtatatcccaccactttatgtgagtttcattttcaaaatgta 12794886  T
540 ggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattctt 616  Q
    |||| | |||| |||||| ||||||||||| ||||| ||||||  | |  ||||||||||||||| ||| |||||||    
12794885 ggtcctacattaatttcatccaataaaagaatgagtattagagtaaatattcaaaagagagtgttactaacattctt 12794809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 423 - 500
Target Start/End: Original strand, 19090204 - 19090281
Alignment:
423 aatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    |||||||||||||||| ||||||||||||||| ||||| ||||||| | ||| ||||||||||| | || ||||||||    
19090204 aatatgaggaatgctagcaacactctcttttgagcactctctctagcactcactcttttattggttgaattcaatgta 19090281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 478 - 613
Target Start/End: Original strand, 1392675 - 1392808
Alignment:
478 ttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgt 577  Q
    ||||||||| | |||||||||||| || | ||||||| |||| |||| ||||  ||| |||||  ||  || |||||| | ||||||| ||||||||| |    
1392675 ttttattggatgaaatcaatgtatgtctcactactttgtatgtgttcaatttttaaaatgtagccca--caatgatttaaaccaataagagagtgagtat 1392772  T
578 tagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| || ||| ||||||||||||||||||||||||    
1392773 tagatagggtgttcaaaagagagtgttgctagcatt 1392808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 552 - 619
Target Start/End: Original strand, 10133276 - 10133343
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||| |||||||| ||||||||||||||||||||| | ||||| ||||||| ||| ||||||||||    
10133276 atttcatccaataaatgagtgagtgttagagagagtgttgaaaagtgagtgtttctaccattcttctt 10133343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 547 - 606
Target Start/End: Original strand, 31116237 - 31116296
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgc 606  Q
    ||||||||||| |||||| |||||||| |||||||||||||| ||||||| |||||||||    
31116237 cattgatttcatccaatagaagagtgaatgttagagagagtgttcaaaagtgagtgttgc 31116296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 527 - 585
Target Start/End: Complemental strand, 9940445 - 9940387
Alignment:
527 tttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagaga 585  Q
    |||||||||||||  || | |||||||||||||||||||||||||||||| ||||||||    
9940445 tttccaaagtgtaaatcctacattgatttcacccaataaaagagtgagtgctagagaga 9940387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 550 - 619
Target Start/End: Original strand, 8441953 - 8442022
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||| |||||||| ||||||||||||||||||||| | ||||  ||||| ||||||||||| ||||    
8441953 tgatttcatccaataaatgagtgagtgttagagagagtgttgaaaaatgagtgctgctagcattcctctt 8442022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 550 - 619
Target Start/End: Original strand, 8450757 - 8450826
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||| |||||||| ||||||||||||||||||||| | ||||  ||||| ||||||||||| ||||    
8450757 tgatttcatccaataaatgagtgagtgttagagagagtgttgaaaaatgagtgctgctagcattcctctt 8450826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 547 - 604
Target Start/End: Original strand, 19737548 - 19737605
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    ||||||||||||||||| |||||||||||| ||||||||||| |||||| | ||||||    
19737548 cattgatttcacccaattaaagagtgagtgctagagagagtgctcaaaataaagtgtt 19737605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 552 - 604
Target Start/End: Complemental strand, 32439538 - 32439486
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    |||||||||||||| |||||||||||||||||||||| |  ||||||||||||    
32439538 atttcacccaataagagagtgagtgttagagagagtgtttgaaagagagtgtt 32439486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 373466 - 373399
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||| ||||||||||| |||| ||| ||||||||||| |||||| ||| ||||| ||||||||    
373466 cattgattttacccaataaaaaagtgggtgctagagagagtgctcaaaaaagaatgttgttagcattc 373399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 543 - 614
Target Start/End: Complemental strand, 12690323 - 12690252
Alignment:
543 catgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| |||||| ||||||||||||  |||||||||||||||| | |||| |||||||  |||||||||    
12690323 catgcattaatttcatccaataaaagagcaagtgttagagagagtgtttaaaatagagtgtccctagcattc 12690252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 510 - 576
Target Start/End: Complemental strand, 6992372 - 6992306
Alignment:
510 actttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtg 576  Q
    ||||||| || ||| ||||||||||||||||||| | ||||||||| || |||||||||| ||||||    
6992372 actttatgtgagtttcatttccaaagtgtaggtcctacattgattttactcaataaaagaatgagtg 6992306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 550 - 624
Target Start/End: Original strand, 17226645 - 17226719
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctttaaat 624  Q
    |||||||| ||||||||||||||| || || |||||||| ||| |||||||||||| ||| |||| || ||||||    
17226645 tgatttcatccaataaaagagtgaatgctaaagagagtgttcagaagagagtgttgttagtattcctcgttaaat 17226719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 547 - 588
Target Start/End: Complemental strand, 4595809 - 4595768
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    |||||||||||| ||||||||||||||||| |||||||||||    
4595809 cattgatttcactcaataaaagagtgagtgctagagagagtg 4595768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 561 - 614
Target Start/End: Complemental strand, 12753811 - 12753758
Alignment:
561 aataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||| |||| |||||||||||| | |||||||||||||||||| ||||    
12753811 aataaaagagcgagtattagagagagtgttgaaaagagagtgttgctagtattc 12753758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 426 - 588
Target Start/End: Original strand, 445813 - 445974
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| ||| ||||  ||||   |||||||||||| | ||| | ||||||||| | |||||||||||| || | | ||||| | |||||||     
445813 atgaggaatgctagcaatactcatttttcaacactatctctagcactcacttttttattggatgaaatcaatgtatgtcacaccactttgtgtgggttca 445912  T
526 atttccaaagtgtag-gtcatgcattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    |||| |||||| ||| ||||  || |||||| | ||||||| ||| ||||| ||||||||||||    
445913 attttcaaagtctagagtca--caatgatttaaaccaataagagaatgagtattagagagagtg 445974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 440 - 588
Target Start/End: Complemental strand, 31116295 - 31116148
Alignment:
440 caacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgta 539  Q
    |||||||| ||||||  |||| ||||||  ||||| |||| |||||| | |||||||||||| |||| ||||||| | || |||| |||||||| |||||    
31116295 caacactcacttttgaacactctctctaacattcactcttctattggatgaaatcaatgtatgtcccactactttgtgtgtgttctatttccaatgtgta 31116196  T
540 ggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
       |   || |||||| | ||||||| ||||||||| ||||||||||||    
31116195 -aacccacaatgatttaaaccaataagagagtgagtattagagagagtg 31116148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 445885 - 445818
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| |||||| |||| | ||||  |||| ||||||||||||    
445885 cattgatttcatccaataaaaaagtgagtgctagagatagtgttgaaaaatgagtattgctagcattc 445818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 21987359 - 21987292
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||| ||||||||    
21987359 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgttagcattc 21987292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 27096360 - 27096418
Alignment:
132 attggtggagaaacccactacaatgtcgtggtaaaatgcatcatattcatgtgtgattt 190  Q
    ||||||||| |||||||| |||||||| |  ||||||||||| || |||||||||||||    
27096360 attggtggacaaacccacaacaatgtcttcttaaaatgcatcttagtcatgtgtgattt 27096418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 604
Target Start/End: Complemental strand, 5106365 - 5106308
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    ||||||||| | ||||||||| ||||||||||||||| |||| | ||||| |||||||    
5106365 cattgattttatccaataaaaaagtgagtgttagagaaagtgttgaaaagtgagtgtt 5106308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 559 - 604
Target Start/End: Complemental strand, 8441902 - 8441857
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    ||||||||||||||||| |||||||||||| |||||| | ||||||    
8441902 ccaataaaagagtgagtattagagagagtgttcaaaaaatagtgtt 8441857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 559 - 604
Target Start/End: Complemental strand, 8450706 - 8450661
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgtt 604  Q
    ||||||||||||||||| |||||||||||| |||||| | ||||||    
8450706 ccaataaaagagtgagtattagagagagtgttcaaaaaatagtgtt 8450661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 575 - 608
Target Start/End: Original strand, 12794955 - 12794988
Alignment:
575 tgttagagagagtgatcaaaagagagtgttgcta 608  Q
    |||||||||||||| |||||||||||||||||||    
12794955 tgttagagagagtgttcaaaagagagtgttgcta 12794988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 566 - 611
Target Start/End: Complemental strand, 29423395 - 29423350
Alignment:
566 aagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||||||||||||||||| ||||| | || |||||||||||    
29423395 aagagtgagtgttagagagagtgttcaaaggtgaatgttgctagca 29423350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 548 - 613
Target Start/End: Complemental strand, 32122861 - 32122796
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||||| ||||||||  |||||||| | || |||||| | |||||||||||||| |||||||    
32122861 attgatttcatccaataaataagtgagtggtggaaagagtgttgaaaagagagtgttgttagcatt 32122796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 117; Significance: 3e-59; HSPs: 54)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 427 - 619
Target Start/End: Complemental strand, 42224775 - 42224583
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcca 526  Q
    |||||||||||| ||||||||||||||| ||||| ||||||| | ||| ||||||||| ||| |||||||||||| |||| | ||||||| |||||||||    
42224775 tgaggaatgctagcaacactctcttttgagcactctctctagcactcactcttttattaggtgaaatcaatgtatgtcccaccactttatgtgggttcca 42224676  T
527 tttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    ||||||||||||||||| | |||||||||||||||||||||||||||||| | ||||||||  ||||||||||||||||||||||||| ||||    
42224675 tttccaaagtgtaggtcctacattgatttcacccaataaaagagtgagtgctggagagagttctcaaaagagagtgttgctagcattcctctt 42224583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 426 - 611
Target Start/End: Complemental strand, 40971638 - 40971453
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||||||||||||||||||| ||||| ||||||| | ||| |||||||||| || |||||||||||| |||| | ||||||| |  ||| |    
40971638 atgaggaatgctaacaacactctcttttgagcactctctctagcactcactcttttattgagtgaaatcaatgtatgtcccaccactttatgtaagtttc 40971539  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||||||||||| | ||||||||| ||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||    
40971538 atttccaaagtgtaggtcttacattgattttacccaataaaatagtgagtgttagatagagtgttcaaaagagagtgttgctagca 40971453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 428 - 611
Target Start/End: Original strand, 4959275 - 4959458
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| ||||||||||||||| ||||| |||||| ||  || ||||||||||||| |||||||||||| || |   | ||||| |||||| |||    
4959275 gaggaatgctagcaacactctcttttgagcactctctctaatacccactcttttattgggtgaaatcaatgtatgtctcatcattttatgtgggttacat 4959374  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    || |||||||||||| || |||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||    
4959375 tttcaaagtgtaggtgatacattgatttcccccaataaaagagtgagtgctagagagagtgctcaaaagagagtgttactagca 4959458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 434 - 614
Target Start/End: Original strand, 26072106 - 26072286
Alignment:
434 tgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaa 533  Q
    ||||||||||||||||||||| ||||| | |||| || ||| |||||| |||||| |||||||||||| || | | ||||||| |||  | |||||||||    
26072106 tgctaacaacactctcttttgagcactctttctaatactcattctttttttgggtgaaatcaatgtatgtctcaccactttatgtggaattcatttccaa 26072205  T
534 agtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||   ||||| |||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||    
26072206 agtgtaggtcccacattgttttcacccaataaaagagtgagtgctagagagaatgctcaaaagagagtgttgctagcattc 26072286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 422 - 614
Target Start/End: Complemental strand, 17568891 - 17568699
Alignment:
422 aaatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatggg 521  Q
    ||||||||| | ||||||||||||  ||||||| | ||| || |||| | ||| |||||||||| || |||||||| ||| |||| | ||||||  | ||    
17568891 aaatatgagaagtgctaacaacacaatcttttgagtactctccctagcactcactcttttattgagtgaaatcaatttatgtcccaccactttaggtagg 17568792  T
522 ttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| |||||||||||||||||| | |||| |||||| |||||||||||||| ||| ||| ||||||| |||||||||||||||||||||||||    
17568791 ttctatttccaaagtgtaggtcctacattaatttcatccaataaaagagtgggtgctagggagagtgctcaaaagagagtgttgctagcattc 17568699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 441 - 611
Target Start/End: Original strand, 6263893 - 6264061
Alignment:
441 aacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtag 540  Q
    |||||||||||||| ||||| ||||||  | ||| || ||||||||||||||||||| ||| |||| | |||||||  |||||||| ||||||||||| |    
6263893 aacactctcttttgagcactctctctatcactcactcctttattgggtaaaatcaatatatgtcccaccactttat--gggttccagttccaaagtgttg 6263990  T
541 gtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
     || | ||||||||||||||| |||||||||||||| |||| |||||| | ||||||||||||||||||||    
6263991 atcttacattgatttcacccactaaaagagtgagtgctagatagagtgcttaaaagagagtgttgctagca 6264061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 457 - 619
Target Start/End: Original strand, 32050333 - 32050495
Alignment:
457 cactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttc 556  Q
    |||| ||||||| ||||| ||||||||||||| |||| ||| ||| || |   ||||||| |||||||||||| |||||||| |  ||| ||||||||||    
32050333 cactctctctagcattcattcttttattgggtgaaattaatatatgtctcatcactttatgtgggttccattttcaaagtgtggaacatacattgatttc 32050432  T
557 acccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    ||||||||||| |||||||| |||||||| || ||||||||||||||||||||||||| ||||    
32050433 acccaataaaaaagtgagtgctagagagaatgctcaaaagagagtgttgctagcattcatctt 32050495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 432 - 614
Target Start/End: Original strand, 8912511 - 8912695
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| |||| |||||||||   |||| | ||||| | ||| ||||||||| |||||||| ||| ||| |||||| ||||| | |||||| |||||||    
8912511 aatgctagcaacgctctcttttaaacactttttctagcactcactcttttatttggtaaaattaatatatgtccctccactttctgtgggtttcatttcc 8912610  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagaga--gtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| |||||  |||||||||||| |||||||||||||||| ||||||||  ||| |||||||||| |||||||| |||||    
8912611 aaagtgtatgtcatatattgatttcacctaataaaagagtgagtgatagagagagtgtgctcaaaagagactgttgctaacattc 8912695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 476 - 620
Target Start/End: Original strand, 24915100 - 24915242
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||| ||| |||||||| ||| |||| | ||||||| |||||||||||| ||||||||| ||| | |||||||||||||||||||||||||||||    
24915100 tcttttattaggtgaaatcaatatatgtcccaccactttatgtgggttccattttcaaagtgtatgtcctacattgatttcacccaataaaagagtgagt 24915199  T
576 gttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    | |  |||||||| | |||||||||||||||||| |||| |||||    
24915200 gct--agagagtgcttaaaagagagtgttgctagtattcctcttt 24915242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 476 - 620
Target Start/End: Original strand, 24990931 - 24991073
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||||| |||||||| ||| |||| | ||||||| | |||||||||| ||||||||| ||| | |||||||||||||||||||||||||||||    
24990931 tcttttattgggtgaaatcaatatatgtcccaccactttatgtaggttccattttcaaagtgtatgtcctacattgatttcacccaataaaagagtgagt 24991030  T
576 gttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    | |  |||||||| | |||||||||||||||||| |||| |||||    
24991031 gct--agagagtgcttaaaagagagtgttgctagtattcctcttt 24991073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 426 - 608
Target Start/End: Complemental strand, 13456348 - 13456170
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| || |||| ||||||| |||||  ||||| || ||| |||||||| || | |||||||||||| |||| | | ||||| ||||||||    
13456348 atgaggaatgctagcagcactttcttttgagcact--ctctattactcactcttttatcggatgaaatcaatgtatttcccaccattttatgtgggttcc 13456251  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgcta 608  Q
    |||| ||||||||||| | | ||||||||||||| |||||||||||||||| |  |||||||  |||||||||||||||||||    
13456250 attttcaaagtgtaggacctacattgatttcacctaataaaagagtgagtgct--agagagtactcaaaagagagtgttgcta 13456170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 476 - 613
Target Start/End: Original strand, 34818231 - 34818368
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    |||||||||  ||||||||||||||| |  | |  |||||| ||||||||||||| ||||| |||||| | ||||||||| ||| ||||||| |||||||    
34818231 tcttttattaagtaaaatcaatgtatgtgtcaccgctttatgtgggttccatttctaaagtataggtcctacattgattttaccaaataaaaaagtgagt 34818330  T
576 gttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||||| |||||||||| |||| ||||||||    
34818331 gttagagagagtgctcaaaagagaatgttcctagcatt 34818368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 428 - 613
Target Start/End: Complemental strand, 28611961 - 28611777
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    |||||||||||||||||||| |||||| ||||| ||||||  ||||| ||||| ||||| || || || ||||| ||||   ||||| |||| |||||||    
28611961 gaggaatgctaacaacactcacttttgagcactctctctaacattcactctttcattggatataaccagtgtatgtcccatcactttgtatgagttccat 28611862  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||  |||||||||  |   || |||||| |  ||||||||||||  ||||||||||||||| ||||||||||||||||||||||||    
28611861 ttttaaagtgtaga-cgcacaatgatttaaatcaataaaagagttggtgttagagagagtgctcaaaagagagtgttgctagcatt 28611777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 547 - 619
Target Start/End: Complemental strand, 4959345 - 4959273
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||| ||||    
4959345 cattgatttcacccaataaaagagtgggtattagagagagtgctcaaaagagagtgttgctagcattcctctt 4959273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 42224704 - 42224771
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
42224704 cattgatttcacctaataaaagagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 42224771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 40971566 - 40971633
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||    
40971566 cattgatttcactcaataaaagagtgagtgctagagagagtgctcaaaagagagtgttgttagcattc 40971633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 548 - 614
Target Start/End: Complemental strand, 6263949 - 6263883
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| |||||||||| ||||||||| ||||||||||| ||||||||||||||| ||| |||||    
6263949 attgattttacccaataaaggagtgagtgatagagagagtgctcaaaagagagtgttactaacattc 6263883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 422 - 499
Target Start/End: Complemental strand, 26072295 - 26072218
Alignment:
422 aaatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgt 499  Q
    ||||||||||||||||| ||||||||||||||| ||| | ||||||| | ||| ||||||||||||| ||| ||||||    
26072295 aaatatgaggaatgctagcaacactctcttttgagcattctctctagcactcactcttttattgggtgaaaacaatgt 26072218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 547 - 611
Target Start/End: Complemental strand, 26072170 - 26072106
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||||||||| |||||| ||||| ||||| |||||| |||||||||||||||| |||||    
26072170 cattgatttcacccaaaaaaagaatgagtattagaaagagtgctcaaaagagagtgttgttagca 26072106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 431 - 603
Target Start/End: Complemental strand, 30326054 - 30325883
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttc 530  Q
    |||||||| ||||| || ||||||  |||| ||| ||| | ||| | ||||||||| | |||||||||||| || | | |||||||  | |||| || ||    
30326054 gaatgctagcaacattcacttttgcacactctctttagcactcactattttattggatgaaatcaatgtatgtctcaccactttatgcgagttctatctc 30325955  T
531 caaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    |||||||||| ||  ||| |||||| | ||||||| | ||||||| |||||||||||| ||||||||||||||    
30325954 caaagtgtagatcc-gcaatgatttaaaccaataagaaagtgagtattagagagagtgttcaaaagagagtgt 30325883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 428 - 619
Target Start/End: Original strand, 34368357 - 34368547
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||   |||||  |||| ||||||  | ||| ||||| ||||| ||||| |||||||| | || | ||||| | |||||||  |    
34368357 gaggaatgctagcaacacttatttttgaacactttctctaacactcactctttcattggataaaaccaatgtatgttccaccactttgtgtgggttcatt 34368456  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    || ||||||||||  |   || |||||| | ||||||| |||||| |||  |||||||||| ||||||||||||||||||||||||| ||||    
34368457 tttcaaagtgtagaccca-caatgatttaaaccaataagagagtgggtgacagagagagtgctcaaaagagagtgttgctagcattcctctt 34368547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 547 - 613
Target Start/End: Original strand, 31542356 - 31542422
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| |||||||||||||||  | |||||||||||||||||| |||||||| ||| |||||||||||    
31542356 cattaatttcacccaataaataaatgagtgttagagagagtgctcaaaagatagttttgctagcatt 31542422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 423 - 500
Target Start/End: Original strand, 42224580 - 42224657
Alignment:
423 aatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    |||| ||||||||||| ||||||||||||||| | ||| |||| || | ||| ||||||||||||| |||||||||||    
42224580 aataagaggaatgctagcaacactctcttttgagaactctctccagcactcactcttttattgggtgaaatcaatgta 42224657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 476 - 588
Target Start/End: Complemental strand, 10142111 - 10142000
Alignment:
476 tcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagt 575  Q
    ||||||||||| |||||||||||||| |||| | ||||| | | |||||||||| ||||||||||  ||  || | |||| |  |||||| |||||||||    
10142111 tcttttattggataaaatcaatgtatgtcccaccactttgtgttggttccattttcaaagtgtagacca-acaattatttaaatcaataagagagtgagt 10142013  T
576 gttagagagagtg 588  Q
    |||||||||||||    
10142012 gttagagagagtg 10142000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 559 - 607
Target Start/End: Complemental strand, 28490775 - 28490727
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgct 607  Q
    ||||||| ||||||||| |||||||||||| ||||||||||||||||||    
28490775 ccaataagagagtgagtattagagagagtgttcaaaagagagtgttgct 28490727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 553 - 613
Target Start/End: Original strand, 30892229 - 30892289
Alignment:
553 tttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||||  |||||||||||||||||||||| |  |||||||||||| ||||||||    
30892229 tttcacccaataggagagtgagtgttagagagagtgctagaaagagagtgttcctagcatt 30892289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 559 - 614
Target Start/End: Original strand, 28611903 - 28611958
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||| ||||||||| |||||||||||||| ||||||| |||||||| ||||||||    
28611903 ccaatgaaagagtgaatgttagagagagtgctcaaaagtgagtgttgttagcattc 28611958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 30325987 - 30326054
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| || ||||||||||||||    
30325987 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagtgaatgttgctagcattc 30326054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 550 - 613
Target Start/End: Complemental strand, 41105632 - 41105569
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||| | ||||||| |||| |||| |||||||||||| |||||||||||||||||| |||||    
41105632 tgatttaaaccaataagagagcgagtattagagagagtgctcaaaagagagtgttgctcgcatt 41105569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 427 - 501
Target Start/End: Complemental strand, 4959465 - 4959391
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtat 501  Q
    |||||| |||||  |||||||||||||| ||||| ||||||| | ||| ||||||||||||  ||||||||||||    
4959465 tgaggagtgctagtaacactctcttttgagcactctctctagcactcactcttttattgggggaaatcaatgtat 4959391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 422 - 500
Target Start/End: Complemental strand, 6264073 - 6263995
Alignment:
422 aaatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||| ||||| ||||||||||||||  ||||| | ||||| | ||| ||||||| ||||| |||||||||||    
6264073 aaatatgaggagtgctagcaacactctcttttaagcactctatctagcactcactcttttagtgggtgaaatcaatgta 6263995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 441 - 611
Target Start/End: Complemental strand, 27592622 - 27592453
Alignment:
441 aacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtag 540  Q
    ||||||| ||||||  |||| ||| ||| | ||| | ||||||||| | |||||||||||| || | | |||||||  | |||| |||||||||||||||    
27592622 aacactcgcttttgcacactctctttagcactcactattttattggatgaaatcaatgtatgtctcaccactttatgcgagttctatttccaaagtgtag 27592523  T
541 gtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
     || |||| |||||| | ||||||| |||||| ||    ||||||||  |||||||||||||||| |||||    
27592522 atc-tgcaatgatttaaaccaataagagagtgggtacaggagagagtattcaaaagagagtgttgatagca 27592453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 550 - 620
Target Start/End: Complemental strand, 28223838 - 28223768
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    |||||| | ||||||||||||||||| ||||||||  || ||||||||| |||||| ||| ||||||||||    
28223838 tgatttaaaccaataaaagagtgagtattagagaggatgttcaaaagagggtgttgttagtattcttcttt 28223768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 431 - 501
Target Start/End: Complemental strand, 32050490 - 32050420
Alignment:
431 gaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtat 501  Q
    |||||||| ||||||||||||||| ||| | ||||||| | ||| | ||||||||||| ||||||||||||    
32050490 gaatgctagcaacactctcttttgagcattctctctagcactcacttttttattgggtgaaatcaatgtat 32050420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 547 - 620
Target Start/End: Complemental strand, 1649617 - 1649544
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    |||| |||||| ||||||| | |||||||||||||||||||| | ||||||||||||  ||| ||||| |||||    
1649617 cattaatttcatccaataagatagtgagtgttagagagagtgttgaaaagagagtgtccctaacattcctcttt 1649544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 561 - 614
Target Start/End: Complemental strand, 2443739 - 2443686
Alignment:
561 aataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||| ||||  |||| |||||| |||||||||||||||||||||||||    
2443739 aataaaagagcgagttctagacagagtgctcaaaagagagtgttgctagcattc 2443686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 524 - 577
Target Start/End: Complemental strand, 27726885 - 27726832
Alignment:
524 ccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgt 577  Q
    |||||||||||||||||| |   |||| ||||||||||||||||||||||||||    
27726885 ccatttccaaagtgtaggacccacattaatttcacccaataaaagagtgagtgt 27726832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 547 - 611
Target Start/End: Complemental strand, 12076127 - 12076063
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||| | ||||| | ||||||||| ||||| | |||| ||||||||||||||||||||||    
12076127 cattgatttaagccaattagagagtgagtattagataaagtgttcaaaagagagtgttgctagca 12076063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 552 - 603
Target Start/End: Original strand, 5990638 - 5990689
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgt 603  Q
    ||||||||||||||||||||||||||| |||| |||| |  |||||||||||    
5990638 atttcacccaataaaagagtgagtgttggagaaagtgttagaaagagagtgt 5990689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 611
Target Start/End: Original strand, 17568816 - 17568879
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||||| ||||||||||||||||| ||| ||||||  ||||||||  |||||| |||||    
17568816 attgatttcactcaataaaagagtgagtgctagggagagtactcaaaagattgtgttgttagca 17568879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 537 - 588
Target Start/End: Original strand, 25710575 - 25710626
Alignment:
537 gtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||| ||| |||||||||||| ||||||||||||||||| || ||||||||    
25710575 gtaggacatacattgatttcacacaataaaagagtgagtgataaagagagtg 25710626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 27592565 - 27592632
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||| |||||||| || ||||||||  |||||| ||||||| |||| ||||    
27592565 cattgatttcatccaataaaatagtgagtgctaaagagagtgtgcaaaagcgagtgttactagaattc 27592632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 614
Target Start/End: Complemental strand, 34368415 - 34368360
Alignment:
559 ccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||| ||||||||||||||||||| |||| ||||||   ||||||||||||||||    
34368415 ccaatgaaagagtgagtgttagagaaagtgttcaaaaataagtgttgctagcattc 34368360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 552 - 586
Target Start/End: Original strand, 18237255 - 18237289
Alignment:
552 atttcacccaataaaagagtgagtgttagagagag 586  Q
    |||||||||||||||||||||||||||||| ||||    
18237255 atttcacccaataaaagagtgagtgttagaaagag 18237289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 549 - 619
Target Start/End: Original strand, 28490837 - 28490907
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    ||||||||| ||||||||| ||||| || ||||||||||  | ||||| || |||||||||||||| ||||    
28490837 ttgatttcatccaataaaaaagtgaatgctagagagagttttgaaaagtgactgttgctagcattcctctt 28490907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 566 - 608
Target Start/End: Original strand, 29155522 - 29155564
Alignment:
566 aagagtgagtgttagagagagtgatcaaaagagagtgttgcta 608  Q
    |||||||||||| |||||||||  |||||||||||||||||||    
29155522 aagagtgagtgtcagagagagttctcaaaagagagtgttgcta 29155564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 565 - 611
Target Start/End: Original strand, 32401251 - 32401297
Alignment:
565 aaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||||||| |||||||||||| ||||||||  ||||||||||||    
32401251 aaagagtgagtattagagagagtgttcaaaagaaggtgttgctagca 32401297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 571 - 613
Target Start/End: Original strand, 40926184 - 40926226
Alignment:
571 tgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||||||||||||| |||||||| ||||||| |||||||    
40926184 tgagtgttagagagagtgctcaaaagaaagtgttgttagcatt 40926226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 550 - 611
Target Start/End: Complemental strand, 2201650 - 2201589
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||| ||||||||| |||||| ||| || |||||||| | ||||||||||||| ||||||    
2201650 tgattttacccaataagagagtgggtgctaaagagagtgttgaaaagagagtgttcctagca 2201589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 552 - 613
Target Start/End: Complemental strand, 8912572 - 8912511
Alignment:
552 atttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| ||| |||||||||||||||| |||| | |||| | ||||||||| ||||||||||||    
8912572 attttaccaaataaaagagtgagtgctagaaaaagtgtttaaaagagagcgttgctagcatt 8912511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 588
Target Start/End: Original strand, 16875378 - 16875419
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtg 588  Q
    ||||||||| ||||||||| ||||||||||||||||| ||||    
16875378 cattgattttacccaataagagagtgagtgttagagaaagtg 16875419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 428 - 500
Target Start/End: Complemental strand, 24915239 - 24915169
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||| ||| ||||||||||||||  |||||  |||||| | ||| ||||||||||||| |||||||||||    
24915239 gaggaatactagcaacactctcttttaagcact--ctctagcactcactcttttattgggtgaaatcaatgta 24915169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 428 - 500
Target Start/End: Complemental strand, 24991070 - 24991000
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||| ||| ||||||||||||||  |||||  |||||| | ||| ||||||||||||| |||||||||||    
24991070 gaggaatactagcaacactctcttttaagcact--ctctagcactcactcttttattgggtgaaatcaatgta 24991000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 547 - 619
Target Start/End: Complemental strand, 36494291 - 36494218
Alignment:
547 cattgatttcacccaat-aaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||| |||||| ||||| |||||||| ||||||||||||| || | |||||||| |||  ||||||||||||||    
36494291 cattaatttcatccaattaaaagagtaagtgttagagagaatgtttaaaagagaatgtctctagcattcttctt 36494218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 108; Significance: 8e-54; HSPs: 84)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 427 - 614
Target Start/End: Original strand, 13919776 - 13919963
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcca 526  Q
    |||| ||||||| ||||||||||||||| ||||| ||||||| | ||  || |||||||||| |||||||||||| |||| | ||||||| |||||||||    
13919776 tgagaaatgctagcaacactctcttttgagcactctctctagcactcgctcatttattgggtgaaatcaatgtatgtcccaccactttatgtgggttcca 13919875  T
527 tttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| ||||||||||||| | |||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||    
13919876 ttttcaaagtgtaggtcctacattgatttcacccaataaatgagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 13919963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 429 - 611
Target Start/End: Original strand, 45909453 - 45909636
Alignment:
429 aggaatgctaacaacactctcttttgtgcactatctctagtattcagtctttt-attgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    |||||||||| ||||||| ||||||| ||||| || |||| ||||| |||||| ||||||| |||||||||||| |||| | ||||||| ||||||||||    
45909453 aggaatgctatcaacactatcttttgagcactctccctagcattcactctttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttccat 45909552  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||||||| |||||||| | ||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||||||||||    
45909553 ttccaaattgtaggtcctacattgattttacccaataaaagagtgagtgttagagagagtattcaaaagagagtgttgctagca 45909636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 428 - 614
Target Start/End: Complemental strand, 26703621 - 26703437
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||||  |||| ||| | ||||||| | ||| ||||||||||||| |||||||||||| || | | ||||||| ||||||||||    
26703621 gaggaatgctagcaacactct--tttgagcattctctctagcactcactcttttattgggtgaaatcaatgtatgtctcaccactttatgtgggttccat 26703524  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| |||||||||||| | |||| ||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||    
26703523 ttctaaagtgtaggtcctacatttatttcacccaataaaagagtgagtgctagagagagtgctcagaagagagtgttgctagcattc 26703437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 426 - 613
Target Start/End: Complemental strand, 25428664 - 25428477
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    |||| |||||||| ||||||||||||||| ||||| | | ||||| ||| |||||||||| || |||||||||||| |||| | ||||||| |||||| |    
25428664 atgatgaatgctagcaacactctcttttgagcactctttttagtactcactcttttattgtgtgaaatcaatgtatgtcccaccactttatgtgggttac 25428565  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    ||||||||||||||| || | ||||||||| | |||||||||||||||||| || |||||||| ||||||||||||||||||| ||||    
25428564 atttccaaagtgtagatcctacattgattttatccaataaaagagtgagtgctaaagagagtgctcaaaagagagtgttgctatcatt 25428477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 470 - 614
Target Start/End: Complemental strand, 19841026 - 19840882
Alignment:
470 attcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaaga 569  Q
    ||||| ||||||||||| | |||||||||||| ||   | ||||||| |||||||||||||||||||||||||| |  ||||||||||||||||||||||    
19841026 attcactcttttattggttgaaatcaatgtatgtcttaccactttatgtgggttccatttccaaagtgtaggtcctatattgatttcacccaataaaaga 19840927  T
570 gtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||| ||||||||||| |||||| ||||||||||||||||||    
19840926 gtgagtgctagagagagtgctcaaaatagagtgttgctagcattc 19840882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 429 - 579
Target Start/End: Complemental strand, 19494521 - 19494371
Alignment:
429 aggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatt 528  Q
    |||||||||| || |||||||||||| | ||| ||||||||| ||| ||||||||||||| |||||||||||| |||| | ||||||| |||||||||||    
19494521 aggaatgctagcagcactctcttttgagtactttctctagtactcactcttttattgggtgaaatcaatgtatgtcccaccactttatgtgggttccatt 19494422  T
529 tccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgtta 579  Q
    | |||||||||| || | |||||||||||||||||||||  ||||||||||    
19494421 ttcaaagtgtagatcctacattgatttcacccaataaaaatgtgagtgtta 19494371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 422 - 614
Target Start/End: Original strand, 14759634 - 14759826
Alignment:
422 aaatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatggg 521  Q
    ||||||||| | ||||||||||||  ||||||| | ||| || |||| | ||| |||||||||| || |||||||| ||| |||| | ||||||  | ||    
14759634 aaatatgagaagtgctaacaacacaatcttttgagtactctccctagcactcactcttttattgagtgaaatcaatttatgtcccaccactttaggtagg 14759733  T
522 ttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||| |||||||||||||||||| | |||| |||||| |||||||||||||| ||| ||| ||||||| |||||||||||||||||||||||||    
14759734 ttctatttccaaagtgtaggtcctacattaatttcatccaataaaagagtgggtgctagggagagtgctcaaaagagagtgttgctagcattc 14759826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 432 - 611
Target Start/End: Complemental strand, 24539302 - 24539123
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| | |||||||||||||  |||| ||||||  | ||| ||||||||||| |||||||||| ||| |||| | ||||||||||| ||||||||||    
24539302 aatgctagcgacactctcttttggacactctctctaacactcactcttttattggataaaatcaatatatgtcccaccactttatatggattccatttcc 24539203  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||| |||| | |   ||||||||| ||||||| | ||||||||||||||||||||||  |||||||||||||||||||||    
24539202 aaaatgtatgacccacattgatttaacccaatgagagagtgagtgttagagagagtgtccaaaagagagtgttgctagca 24539123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 423 - 573
Target Start/End: Original strand, 22786143 - 22786293
Alignment:
423 aatatgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggt 522  Q
    ||||| |||||||||| ||||||||||||||| ||||| ||||||| | ||| | ||||||| ||| |||||||||||| || | | ||||||| |||||    
22786143 aatataaggaatgctagcaacactctcttttgagcactctctctagcactcacttttttattaggtgaaatcaatgtatgtctcaccactttatgtgggt 22786242  T
523 tccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtga 573  Q
    |||||||||||||||||||| || |||||||||||||  ||||||||||||    
22786243 tccatttccaaagtgtaggttatacattgatttcacctgataaaagagtga 22786293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 428 - 576
Target Start/End: Complemental strand, 17354710 - 17354562
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| ||||||||| ||||| ||||| ||||||  | ||| ||||||||||| | |||||||||||| |||| | ||||||| ||||||| ||    
17354710 gaggaatgctagcaacactcttttttgagcactctctctaacactcattcttttattggatgaaatcaatgtatgtcccaccactttatgtgggttctat 17354611  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtg 576  Q
    |||||||||||||||| | ||||||||| ||||||||||| ||||||||    
17354610 ttccaaagtgtaggtcctacattgattttacccaataaaaaagtgagtg 17354562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 432 - 611
Target Start/End: Original strand, 17749695 - 17749874
Alignment:
432 aatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccatttcc 531  Q
    ||||||| | ||||||| |||||  |||| ||||||  | ||| ||||||||||| |||||||||| ||| |||| | ||||||||||| || |||||||    
17749695 aatgctagcgacactcttttttggacactctctctaacactcactcttttattggataaaatcaatatatgtcccaccactttatatggatttcatttcc 17749794  T
532 aaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    ||| |||| | |   ||||||||| ||||||| | ||||||||||||||||||||||  |||||||||||||||||||||    
17749795 aaaatgtatgacccacattgatttaacccaatgagagagtgagtgttagagagagtgtccaaaagagagtgttgctagca 17749874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 428 - 623
Target Start/End: Original strand, 27888279 - 27888473
Alignment:
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttccat 527  Q
    ||||||||||| |||||||| |||||| ||||| ||||||  | |||  || | ||||| |||||||||||||| |||| | ||||| | ||||||| ||    
27888279 gaggaatgctagcaacactcacttttgagcactctctctaacactcaccctctcattggataaaatcaatgtatgtcccaccactttgtgtgggttcaat 27888378  T
528 ttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctttaaa 623  Q
    ||  |||||||||  |   || |||||| | ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||    
27888379 ttttaaagtgtagaccca-caatgatttaaaccaataagagagtgagtgttagagagagtgctcaaaagagagtgttgctagcattcctctataaa 27888473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 488 - 605
Target Start/End: Original strand, 26189960 - 26190077
Alignment:
488 taaaatcaatgtatatccctctactttatatgggttccatttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagt 587  Q
    ||||||||||| || |||| | || | || |||||| ||||| ||||||||||||| | | ||||||| ||||||||||||||||||||||||||| |||    
26189960 taaaatcaatgcatgtcccaccacctcatgtgggtttcattttcaaagtgtaggtcctacgttgattttacccaataaaagagtgagtgttagagaaagt 26190059  T
588 gatcaaaagagagtgttg 605  Q
    | ||||||||||||||||    
26190060 gttcaaaagagagtgttg 26190077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 220 - 288
Target Start/End: Original strand, 10477729 - 10477797
Alignment:
220 tttcaaccaaataattttaccatttgaatattgttgaaatattaacattctttttgaagcgcataaaaa 288  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||    
10477729 tttcaaccaagtaattttaccatttgaatattgttgaaatattaacattctttttggagcgcagaaaaa 10477797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 530 - 621
Target Start/End: Complemental strand, 37549708 - 37549617
Alignment:
530 ccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttta 621  Q
    |||||||||||||| | |||||| |||| ||||||||||||| |||| |||||| |||| ||||||||||||||||||||||||| ||||||    
37549708 ccaaagtgtaggtcctacattgaattcaaccaataaaagagtaagtgctagagaaagtgctcaaaagagagtgttgctagcattcctcttta 37549617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 17354640 - 17354707
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||    
17354640 cattgatttcatccaataaaagaatgagtgttagagagagtgctcaaaaaagagtgttgctagcattc 17354707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 426 - 613
Target Start/End: Original strand, 22189934 - 22190120
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    |||||||||||||  |||||||  ||||   |||| ||||||| | ||| ||||||||||| | ||||||||||||  ||| | ||||| | |||||||     
22189934 atgaggaatgctagaaacactcatttttcaacactctctctagcactcactcttttattggatgaaatcaatgtatggcccaccactttgtgtgggttca 22190033  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||| ||||||||||  |  ||| |||||| | |||||||| |||||||| |||||||| ||| |||||||||||||||| |||||||    
22190034 attttcaaagtgtagaccc-gcaatgatttaaaccaataaacgagtgagtattagagagggtgttcaaaagagagtgttgttagcatt 22190120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 547 - 614
Target Start/End: Complemental strand, 22786218 - 22786151
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||| ||||||| |||||||| ||||||||||| |||||||||||||||||||||||||    
22786218 cattgatttcacctaataaaaaagtgagtgctagagagagtgctcaaaagagagtgttgctagcattc 22786151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 547 - 613
Target Start/End: Complemental strand, 13919847 - 13919781
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||||||||||||||| ||| ||||| ||||||||||| ||||||||||||||||||||||||    
13919847 cattgatttcacccaataaatgagcgagtgctagagagagtgctcaaaagagagtgttgctagcatt 13919781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 427 - 607
Target Start/End: Original strand, 33008100 - 33008276
Alignment:
427 tgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcca 526  Q
    |||||||||||| |||||||| ||||||  |||||||||||| | ||| ||||||||||| | |||||| ||||| |||| | ||||| | ||||||| |    
33008100 tgaggaatgctagcaacactcacttttgaacactatctctagcactcactcttttattggatgaaatcattgtatgtcccaccactttgtgtgggttcta 33008199  T
527 tttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgct 607  Q
    ||||||| ||||| | |   || |||||| | |||||||||||| |||| |||   |||||| ||||||||||||||||||    
33008200 tttccaatgtgta-gacccacaatgatttaaaccaataaaagagagagtatta---agagtgttcaaaagagagtgttgct 33008276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 549 - 620
Target Start/End: Original strand, 31502579 - 31502650
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    ||||||||| ||||||||||||||||||||||||||| || | ||||| ||||||||||||||||| |||||    
31502579 ttgatttcatccaataaaagagtgagtgttagagagactgttgaaaagtgagtgttgctagcattcctcttt 31502650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 549 - 611
Target Start/End: Complemental strand, 2520698 - 2520636
Alignment:
549 ttgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagca 611  Q
    |||||||||||||||||||||||||||||| ||||||||| | ||||||||||||| ||||||    
2520698 ttgatttcacccaataaaagagtgagtgttggagagagtgttgaaaagagagtgttcctagca 2520636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 537 - 621
Target Start/End: Complemental strand, 32205153 - 32205072
Alignment:
537 gtaggtcatgcattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttta 621  Q
    ||||| ||| ||||||||||| |||||||||||||||||   |||||||||| ||||||| ||||||||||||||||| ||||||    
32205153 gtaggacatacattgatttcatccaataaaagagtgagt---agagagagtgttcaaaagtgagtgttgctagcattcctcttta 32205072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 548 - 613
Target Start/End: Original strand, 24539237 - 24539302
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||| | ||||||||||||||||||||||||||||||  ||||||||||||| |||||||||    
24539237 attgattttatccaataaaagagtgagtgttagagagagtgtccaaaagagagtgtcgctagcatt 24539302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 547 - 619
Target Start/End: Original strand, 26703553 - 26703623
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    |||||||||||||||||||||||||||||| |||||||| || |||||  |||||||||||||||||| ||||    
26703553 cattgatttcacccaataaaagagtgagtgctagagagaatgctcaaa--agagtgttgctagcattcctctt 26703623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 547 - 619
Target Start/End: Original strand, 19422947 - 19423019
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttctt 619  Q
    ||||||||||| ||||| |||||||||||| ||||||||||| | ||||| ||||||||||| ||||||||||    
19422947 cattgatttcatccaatgaaagagtgagtgatagagagagtgttgaaaagtgagtgttgctaacattcttctt 19423019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 550 - 614
Target Start/End: Complemental strand, 33008168 - 33008104
Alignment:
550 tgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||| |||||||||||||||||| |||||| |||| ||||||| |||||||||||||||||    
33008168 tgatttcatccaataaaagagtgagtgctagagatagtgttcaaaagtgagtgttgctagcattc 33008104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 426 - 585
Target Start/End: Complemental strand, 10619576 - 10619419
Alignment:
426 atgaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgtatatccctctactttatatgggttcc 525  Q
    ||||||||||||| |||||||||||||||  |||| ||||||| |   | ||| || |||||| |||||||| ||||||||   ||||||| ||||||||    
10619576 atgaggaatgctagcaacactctcttttgatcactctctctagcacctactctctt-ttgggtgaaatcaatatatatcccatcactttatgtgggttcc 10619478  T
526 atttccaaagtgtaggtcatgcattgatttcacccaataaaagagtgagtgttagagaga 585  Q
    |||  ||||||||| || |  ||||||||||||| ||||||||||| | || ||||||||    
10619477 attgacaaagtgtaagtta-acattgatttcacctaataaaagagtaaatgctagagaga 10619419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 19494452 - 19494519
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||||||||||||||||||||  |||||| |||  ||||||||||||| |||||||||||    
19494452 cattgatttcacccaataaaagagtgagtactagagaaagtactcaaaagagagtgctgctagcattc 19494519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 614
Target Start/End: Original strand, 25428592 - 25428659
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    |||||||||||| ||||||||||||||||  || | |||||| |||||||||||||||||||||||||    
25428592 cattgatttcacacaataaaagagtgagtactaaaaagagtgctcaaaagagagtgttgctagcattc 25428659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 548 - 614
Target Start/End: Original strand, 10619506 - 10619571
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattc 614  Q
    ||||||||||||||| || |||||  ||| |||||||||||||||||||||||||||||||||||||    
10619506 attgatttcacccaa-aagagagtaggtgctagagagagtgatcaaaagagagtgttgctagcattc 10619571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 547 - 617
Target Start/End: Complemental strand, 14795198 - 14795128
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttc 617  Q
    ||||||||||| ||||||||| ||||| || ||||||||||| | ||||| ||||||||||||||||||||    
14795198 cattgatttcatccaataaaaaagtgactgatagagagagtgttgaaaagtgagtgttgctagcattcttc 14795128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 547 - 617
Target Start/End: Complemental strand, 15242190 - 15242120
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttc 617  Q
    ||||||||||| ||||||||| ||||| || ||||||||||| | ||||| ||||||||||||||||||||    
15242190 cattgatttcatccaataaaaaagtgactgatagagagagtgttgaaaagtgagtgttgctagcattcttc 15242120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 548 - 613
Target Start/End: Complemental strand, 17749760 - 17749695
Alignment:
548 attgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcatt 613  Q
    |||||||| | ||||||||||||||||||||||||||||||  ||||| ||||||| |||||||||    
17749760 attgattttatccaataaaagagtgagtgttagagagagtgtccaaaaaagagtgtcgctagcatt 17749695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 547 - 620
Target Start/End: Complemental strand, 27888349 - 27888276
Alignment:
547 cattgatttcacccaataaaagagtgagtgttagagagagtgatcaaaagagagtgttgctagcattcttcttt 620  Q
    ||||||||| | ||||| | || ||||||||||||||||||| ||||||| ||||||||||||||||| |||||    
27888349 cattgattttatccaatgagagggtgagtgttagagagagtgctcaaaagtgagtgttgctagcattcctcttt 27888276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 428 - 500
Target Start/End: Complemental strand, 13919966 - 13919894
Alignment:
</
428 gaggaatgctaacaacactctcttttgtgcactatctctagtattcagtcttttattgggtaaaatcaatgta 500  Q
    ||||||||||| ||||||||||||||| ||||| ||||||| | ||| || |||||||||| |||||||||||