View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L3_20 (Length: 655)

Name: R108-L3_20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L3_20
R108-L3_20
[»] chr4 (4 HSPs)
chr4 (1-374)||(55855364-55855719)
chr4 (147-282)||(55863811-55863946)
chr4 (367-500)||(55856705-55856840)
chr4 (12-70)||(55863961-55864019)
[»] chr3 (3 HSPs)
chr3 (90-275)||(1995149-1995333)
chr3 (12-85)||(1994707-1994780)
chr3 (289-374)||(1995928-1996014)


Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 55855719 - 55855364
Alignment:
1 aaaagaacagttaccaatctgacgcacgatatgaaattaggtgggttagacctccatgaattgcatatatcaagatgaatttggtttatttagataagtg 100  Q
    |||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
55855719 aaaagaacggttaccaatctgacacacgatatgaaattaggtgggtcagacctccatgaattgcatatatcaagatgaatttggtttatttagataagtg 55855620  T
101 agaaaactaatatcgacggtgtaatcaactatcagtggaaatagtcttgcataggtccattttgttttacattttaataatttcaacctttaataaattt 200  Q
    |||||||||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
55855619 agaaaactaatatcgacggtgtaatcaactacgagtggaaattgtcttgcataggtccattttgttttatattttaataatttcaacctttaataaattt 55855520  T
201 caaagtataaaaaattaagattgaaaatgatattattaaagtggatttaaatgttgacaacgacccagtattgaattaagtattgaattaagtactatct 300  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||                      
55855519 caaagtacaaaaaattaagattgaaaatgatattattaaagtggatttaaatgttgacagcgacccagtattgaattaagta------------------ 55855438  T
301 gccatctggccatgccacgtttaagaggtcaattgtttaggcccacttt-aaaataagtaccctcccaaattaat 374  Q
     |||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||  ||||||||||||    
55855437 -ccatctggccatgccatgtttaagaggtcaattgtttaggcccactttaaaaagaagtactatcccaaattaat 55855364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 147 - 282
Target Start/End: Complemental strand, 55863946 - 55863811
Alignment:
147 ttgcataggtccattttgttttacattttaataatttcaacctttaataaatttcaaagtataaaaaattaagattgaaaatgatattattaaagtggat 246  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||  ||||||||||||||    
55863946 ttgcatagatccattttgttttacattttaataatttcaacctttaat-aatttcaaagtacaaaaaattaggattgaaaatgacgttattaaagtggat 55863848  T
247 ttaaat-gttgacaacgacccagtattgaattaagta 282  Q
    |||||| | ||||  ||||||| ||||||||||||||    
55863847 ttaaatggatgacggcgacccactattgaattaagta 55863811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 367 - 500
Target Start/End: Complemental strand, 55856840 - 55856705
Alignment:
367 aaattaatcagcacccaacaatcaaaaggtctctctcaccaaccataatag-cctnatgttaagntagcnacgtttgtctttagccccccanagaaaaca 465  Q
    |||||||| |||||| ||||||||||||| |||| |||||||||||||||| ||| |||||||| || | |||||||||||||||| || |   ||||||    
55856840 aaattaattagcacctaacaatcaaaagggctctgtcaccaaccataatagccctaatgttaagttaacaacgtttgtctttagccaccaaagaaaaaca 55856741  T
466 tgcttaacctttatctagcaa--aagacatanattat 500  Q
    | ||||| |||||||||| ||  |||||||| |||||    
55856740 tacttaa-ctttatctagaaactaagacatagattat 55856705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 55864019 - 55863961
Alignment:
12 taccaatctgacgcacgatatgaaattaggtgggttagacctccatgaattgcatatat 70  Q
    |||||||| ||| ||| || ||||||||||||||||| |||||||||||||||||||||    
55864019 taccaatccgacacacaatgtgaaattaggtgggttaaacctccatgaattgcatatat 55863961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 118; Significance: 7e-60; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 7e-60
Query Start/End: Original strand, 90 - 275
Target Start/End: Original strand, 1995149 - 1995333
Alignment:
90 ttagataagtgagaaaactaatatcgacggtgtaatcaactatcagtggaaatagtcttgcataggtccattttgttttacattttaataatttcaacct 189  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||    
1995149 ttagttaagtgagaaaactaatatcgacggtgtaatcaactatcagtgaaaattgtcttgcataggtccattttgttttacattttaataattttaacct 1995248  T
190 ttaataaatttcaaagtataaaaaattaagattgaaaatgatattattaaagtggatttaaatgttgacaacgacccagtattgaa 275  Q
    ||||| |||||||||||| |||| |||| |||||||||| |||||||| |||| |||||||||  ||| | ||||||| |||||||    
1995249 ttaat-aatttcaaagtacaaaatattaggattgaaaattatattattgaagtagatttaaattatgatagcgacccaatattgaa 1995333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 12 - 85
Target Start/End: Original strand, 1994707 - 1994780
Alignment:
12 taccaatctgacgcacgatatgaaattaggtgggttagacctccatgaattgcatatatcaagatgaatttggt 85  Q
    ||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||    
1994707 taccaatctaacacacgatatgaaattaggtgggttggacctccatgaattgcatatatgaagatgaatttggt 1994780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 289 - 374
Target Start/End: Original strand, 1995928 - 1996014
Alignment:
289 taagtactatctgccatctggccatgccacgtttaagaggtcaattgtttaggcccact-ttaaaataagtaccctcccaaattaat 374  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||| | ||||| | |||| ||||||| ||||||||||||    
1995928 taagtaatatctaccatctggccatgccacgtttaagaggtcaattgtttaagtccactataaaaagaagtaccatcccaaattaat 1996014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110711 times since January 2019
Visitors: 1335