View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L3_21 (Length: 253)

Name: R108-L3_21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L3_21
R108-L3_21
[»] chr4 (3 HSPs)
chr4 (144-253)||(55856705-55856817)
chr4 (2-120)||(55855715-55855829)
chr4 (2-64)||(55864037-55864100)
[»] chr5 (1 HSPs)
chr5 (160-234)||(18680317-18680391)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 144 - 253
Target Start/End: Original strand, 55856705 - 55856817
Alignment:
144 ataatctatgtctt--ttgctagataaagttaagcatgtttttctttggtggctaaagacaaacgttgctaacttaacatta-ggctattatggttggtg 240  Q
    ||||||||||||||  || ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||    
55856705 ataatctatgtcttagtttctagataaagttaagtatgtttttctttggtggctaaagacaaacgttgttaacttaacattagggctattatggttggtg 55856804  T
241 agagagacctttt 253  Q
    | |||| ||||||    
55856805 acagagccctttt 55856817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 2 - 120
Target Start/End: Original strand, 55855715 - 55855829
Alignment:
2 ctttttaggctcctttaatgtcttataggtctctaataaatcaagaaataactcctgaatgtannnnnnnnccttctaatttagtttatgtttgagtcat 101  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||     ||||         |||||||||||||||||||||||||||||    
55855715 ctttttaggctcctttaatgtcttctaggtctctaataaatcaagaaataact----tatgtgttttttttccttctaatttagtttatgtttgagtcat 55855810  T
102 ttgaaataaaagaaatgac 120  Q
    || |||| |||||||||||    
55855811 ttaaaatgaaagaaatgac 55855829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 64
Target Start/End: Original strand, 55864037 - 55864100
Alignment:
2 ctttttaggctccttta-atgtcttataggtctctaataaatcaagaaataactcctgaatgta 64  Q
    ||||||||| ||||||| ||||||| |||||||||||||||| | ||||||||| |||||||||    
55864037 ctttttagggtcctttacatgtcttctaggtctctaataaattaggaaataacttctgaatgta 55864100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 234
Target Start/End: Original strand, 18680317 - 18680391
Alignment:
160 gctagataaagttaagcatgtttttctttggtggctaaagacaaacgttgctaacttaacattaggctattatgg 234  Q
    ||||||||  ||||||||||||| ||||| ||| || |||||||| ||||||||||||    |||||||||||||    
18680317 gctagatatggttaagcatgtttctcttttgtgactgaagacaaaagttgctaacttagttgtaggctattatgg 18680391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360703 times since January 2019
Visitors: 484