View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L3_8 (Length: 522)

Name: R108-L3_8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L3_8
R108-L3_8
[»] chr6 (4 HSPs)
chr6 (146-522)||(2063761-2064129)
chr6 (406-522)||(2059999-2060113)
chr6 (396-477)||(2055708-2055789)
chr6 (229-307)||(2060223-2060298)


Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 146 - 522
Target Start/End: Complemental strand, 2064129 - 2063761
Alignment:
146 tcgttatctccatatttcttcatatttcctacactatgagctcacaaggcaaacgtagatactttgggttcattctacaaatattttacgttttttagtt 245  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||  ||||||||||| || |||||||||||||||||||||||||||||    
2064129 tcgttatctccatatttcttcatatttcctacactatgaattcacaaggcaaacacagatactttggatttattctacaaatattttacgttttttagtt 2064030  T
246 ttacagttacacaatgaaaactgtgagttaaatactcacacctcacctaaagattcaaagtgaagcaagcacttcagagtaaaaaatttgcaaaatcaaa 345  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2064029 ttacggttacacaatgaaaactgtgagttaaatgctcacacctcacctaaagattcaaagtgaagcaagcacttcagagtaaaaaatttgcaaaatcaaa 2063930  T
346 tttccga---annnnnnnnnnnggagtcctaacagtatattctaaaattatgttaaagtttaagacttcaagtcaaatgattaggaagaatgctatgtgt 442  Q
    |||||||               |||||||||||||||| ||||||||||| ||||||||||           | |||| | |||||||||||||||||||    
2063929 tttccgatttttttttttttttggagtcctaacagtatgttctaaaattacgttaaagttt-----------tgaaattactaggaagaatgctatgtgt 2063841  T
443 aaacaaagctcaattttagggtcaaaaacatcaaaacaccatcaatcatggtggtcatcaatcaaatagcaaatagtttt 522  Q
    |||||||||||| ||||||||| ||||||||||||||||| | | |||||||||||||||||||||||||||||||||||    
2063840 aaacaaagctcatttttagggtaaaaaacatcaaaacaccttaagtcatggtggtcatcaatcaaatagcaaatagtttt 2063761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 406 - 522
Target Start/End: Complemental strand, 2060113 - 2059999
Alignment:
406 gacttcaagtcaaatgattaggaagaatgctatgtgtaaacaaagctcaattttagggtcaaaaacatcaaaacaccatcaatcatggtggtcatcaatc 505  Q
    ||||||||||||||| |||||||||||   ||||| |||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||    
2060113 gacttcaagtcaaattattaggaagaact-tatgtataaaaaaagctcatttttagggtcaaaaacatcaaaacacc-tcaatcatggtggtcatcaatc 2060016  T
506 aaatagcaaatagtttt 522  Q
    |||||||||||||||||    
2060015 aaatagcaaatagtttt 2059999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 396 - 477
Target Start/End: Complemental strand, 2055789 - 2055708
Alignment:
396 taaagtttaagacttcaagtcaaatgattaggaagaatgctatgtgtaaacaaagctcaattttagggtcaaaaacatcaaa 477  Q
    |||||||||||| |||||||||||| ||||||||||| | ||||| ||||  ||||||| |||||||||||||| |||||||    
2055789 taaagtttaagatttcaagtcaaattattaggaagaacgttatgtataaaagaagctcatttttagggtcaaaatcatcaaa 2055708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 2060298 - 2060223
Alignment:
229 ttttacgttttttagttttacagttacacaa-tgaaaactgtgagttaaatactcacacctcacctaaagattcaaagtg 307  Q
    ||||||||| |||||||||||||| |||||| |||||||  |||||||||||||  ||||||||| ||||||||||||||    
2060298 ttttacgttctttagttttacagtcacacaagtgaaaac--tgagttaaatact--cacctcaccaaaagattcaaagtg 2060223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202638 times since January 2019
Visitors: 1517