View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L4 (Length: 615)

Name: R108-L4
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L4
R108-L4
[»] chr3 (2 HSPs)
chr3 (1-424)||(42524921-42525336)
chr3 (541-615)||(42525332-42525406)
[»] chr5 (1 HSPs)
chr5 (273-421)||(29282575-29282723)
[»] chr8 (1 HSPs)
chr8 (273-421)||(6470269-6470417)


Alignment Details
Target: chr3 (Bit Score: 383; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 1 - 424
Target Start/End: Complemental strand, 42525336 - 42524921
Alignment:
1 cattatagttttgtgattctgatctcaaaattgcagtagtgatgccgttgtagagacctcaaaattatttatattgaggccgcaattgcattgcagttgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42525336 cattatagttttgtgattctgatctcaaaattgcagtagtgatgccgttgtagagacctcaaaattatttatattgaggccgcaattgcattgcagttgc 42525237  T
101 ggacaataatttaataacaaatacaactaaaaaggctacatataatttaaaaactactcatacaatttcacctaaccattttccaatactgtttccataa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
42525236 ggacaataatttaataacaaatacaactaaaaaggctacatataatttaaaaactattcatacaatttcacctaaccattttccaatactgtttccataa 42525137  T
201 acatgctaattaacaaagcatgctttatacatgaatgctagtcttgcatatgatgtgaaaatgtgaatgtgataatgtaggagtacaaacagtagagact 300  Q
    |||||||||||||| |||||||||||||||||||||| |||||||||||||||||        |||||||||||||||||||||||||||||||||||||    
42525136 acatgctaattaaccaagcatgctttatacatgaatgttagtcttgcatatgatg--------tgaatgtgataatgtaggagtacaaacagtagagact 42525045  T
301 gagcatagcacaggaaaggttattgtgacggggaccatggacggcaacaagttagtggattttgtttatagacgaactaaaaagcaagccaaaatagttc 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42525044 gagcatagcacaggaaaggttattgtgacggggaccatggacggcaacaagttagtggattttgtttatagacgaactaaaaagcaagccaaaatagttc 42524945  T
401 cacaaccagaacctgaaccagcac 424  Q
    ||||||||||||||||||||||||    
42524944 cacaaccagaacctgaaccagcac 42524921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 541 - 615
Target Start/End: Complemental strand, 42525406 - 42525332
Alignment:
541 attaattttcac-aaatgtgctaaaattggaagnnnnnnnntgatttcttaatgatcaagttatgtggttccatta 615  Q
    |||||||||||| ||||||||||||||||||||        |||||||||||||||||||||||||||||||||||    
42525406 attaattttcaccaaatgtgctaaaattggaagaaaaaaa-tgatttcttaatgatcaagttatgtggttccatta 42525332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 273 - 421
Target Start/End: Original strand, 29282575 - 29282723
Alignment:
273 taatgtaggagtacaaacagtagagactgagcatagcacaggaaaggttattgtgacggggaccatggacggcaacaagttagtggattttgtttataga 372  Q
    |||||||||||| ||||||| || ||| |||  ||||||||| || || | |||||| || || ||||| |  |||||| ||||||||| ||| ||||||    
29282575 taatgtaggagttcaaacagcagtgacagagtttagcacagggaaagtaactgtgacaggaacaatggatgcaaacaagctagtggattatgtctataga 29282674  T
373 cgaactaaaaagcaagccaaaatagttccacaaccagaacctgaaccag 421  Q
     |||| ||||| ||||| |||||||||||  |||| |||||||||||||    
29282675 agaaccaaaaaacaagcgaaaatagttcctaaacccgaacctgaaccag 29282723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 273 - 421
Target Start/End: Complemental strand, 6470417 - 6470269
Alignment:
273 taatgtaggagtacaaacagtagagactgagcatagcacaggaaaggttattgtgacggggaccatggacggcaacaagttagtggattttgtttataga 372  Q
    |||||||||||| ||||||| || | | |||  ||||||| | || || | |||||| || || ||||| |  |||||| ||||||||| ||| |||| |    
6470417 taatgtaggagttcaaacagcagtggcagagtttagcacaaggaaagtaactgtgacaggaacaatggatgcaaacaagctagtggattatgtctataaa 6470318  T
373 cgaactaaaaagcaagccaaaatagttccacaaccagaacctgaaccag 421  Q
      ||| ||||| ||||| |||||||||||  ||||||||||||||||||    
6470317 aaaaccaaaaaacaagcaaaaatagttcctaaaccagaacctgaaccag 6470269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 307126 times since January 2019
Visitors: 441