View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L4_33 (Length: 441)

Name: R108-L4_33
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L4_33
R108-L4_33
[»] chr4 (85 HSPs)
chr4 (13-312)||(9396704-9397004)
chr4 (8-308)||(15640716-15641016)
chr4 (13-310)||(3018016-3018315)
chr4 (7-312)||(46046497-46046802)
chr4 (8-312)||(9516683-9516988)
chr4 (6-302)||(13132024-13132319)
chr4 (13-312)||(38574041-38574341)
chr4 (7-312)||(37012780-37013085)
chr4 (13-312)||(9618985-9619284)
chr4 (11-312)||(48579939-48580241)
chr4 (7-312)||(31090134-31090440)
chr4 (13-312)||(7819020-7819319)
chr4 (26-312)||(34064055-34064342)
chr4 (13-312)||(4355887-4356186)
chr4 (18-312)||(31943959-31944255)
chr4 (6-312)||(3273619-3273925)
chr4 (51-312)||(18713003-18713265)
chr4 (93-312)||(18667375-18667594)
chr4 (190-312)||(26252419-26252542)
chr4 (157-312)||(48259901-48260056)
chr4 (13-194)||(35376168-35376346)
chr4 (7-150)||(38573968-38574111)
chr4 (13-150)||(9516615-9516753)
chr4 (77-194)||(26252337-26252455)
chr4 (202-316)||(35376322-35376437)
chr4 (7-119)||(9619245-9619358)
chr4 (8-150)||(31090060-31090204)
chr4 (13-143)||(34063987-34064118)
chr4 (8-169)||(41947072-41947232)
chr4 (6-150)||(9396934-9397078)
chr4 (8-120)||(26252502-26252615)
chr4 (10-150)||(37012709-37012850)
chr4 (7-150)||(31944185-31944329)
chr4 (13-150)||(48259986-48260123)
chr4 (11-143)||(48579869-48580002)
chr4 (13-150)||(15640950-15641089)
chr4 (11-150)||(4356116-4356255)
chr4 (8-150)||(3273855-3273996)
chr4 (6-122)||(46046428-46046539)
chr4 (7-89)||(48259822-48259904)
chr4 (6-150)||(3018247-3018390)
chr4 (7-118)||(12904746-12904857)
chr4 (243-312)||(7819087-7819156)
chr4 (13-150)||(13131945-13132084)
chr4 (6-77)||(31218290-31218361)
chr4 (13-139)||(35376374-35376500)
chr4 (7-143)||(18713202-18713341)
chr4 (243-312)||(46046660-46046729)
chr4 (7-83)||(36887679-36887755)
chr4 (273-312)||(9619053-9619092)
chr4 (273-312)||(26252341-26252380)
chr4 (243-312)||(37012943-37013012)
chr4 (243-312)||(3018085-3018154)
chr4 (243-312)||(38574204-38574273)
chr4 (20-120)||(31083362-31083463)
chr4 (26-122)||(43312227-43312324)
chr4 (6-55)||(50462727-50462776)
chr4 (7-89)||(41946964-41947043)
chr4 (7-83)||(53896445-53896520)
chr4 (273-312)||(3273695-3273734)
chr4 (273-312)||(9516876-9516915)
chr4 (7-70)||(18667606-18667669)
chr4 (273-312)||(31090327-31090366)
chr4 (273-312)||(34064248-34064287)
chr4 (8-83)||(43313515-43313589)
chr4 (243-312)||(4355954-4356023)
chr4 (31-89)||(12904881-12904939)
chr4 (243-312)||(18713033-18713102)
chr4 (274-312)||(31944023-31944061)
chr4 (7-122)||(36888943-36889057)
chr4 (190-226)||(36888943-36888979)
chr4 (190-226)||(43312288-43312324)
chr4 (7-55)||(46935170-46935218)
chr4 (273-308)||(13132207-13132242)
chr4 (273-312)||(15640788-15640827)
chr4 (273-316)||(43312278-43312321)
chr4 (273-312)||(48580132-48580171)
chr4 (243-312)||(9396772-9396841)
chr4 (273-307)||(9516772-9516806)
chr4 (274-312)||(12904819-12904857)
chr4 (274-312)||(35376235-35376273)
chr4 (266-307)||(31090216-31090257)
chr4 (7-99)||(12520636-12520731)
chr4 (330-373)||(26252559-26252601)
chr4 (6-70)||(46934069-46934133)
[»] chr5 (63 HSPs)
chr5 (6-312)||(7125990-7126297)
chr5 (5-308)||(6817199-6817502)
chr5 (7-308)||(20709289-20709590)
chr5 (7-312)||(14143901-14144206)
chr5 (13-312)||(41001426-41001725)
chr5 (7-312)||(17762282-17762587)
chr5 (13-312)||(29444811-29445111)
chr5 (13-312)||(31799713-31800012)
chr5 (6-312)||(24074301-24074607)
chr5 (8-312)||(24837242-24837547)
chr5 (6-312)||(24650773-24651079)
chr5 (13-312)||(4919063-4919362)
chr5 (8-312)||(993820-994123)
chr5 (8-312)||(18336467-18336761)
chr5 (6-194)||(14411695-14411884)
chr5 (12-194)||(27159148-27159328)
chr5 (147-312)||(23979042-23979206)
chr5 (8-150)||(23979136-23979279)
chr5 (11-150)||(7125921-7126060)
chr5 (6-143)||(24837167-24837305)
chr5 (6-150)||(14144136-14144281)
chr5 (190-312)||(14411848-14411971)
chr5 (6-150)||(17762517-17762662)
chr5 (7-150)||(6817122-6817265)
chr5 (31-303)||(22571159-22571432)
chr5 (190-316)||(27159059-27159184)
chr5 (7-146)||(22571076-22571216)
chr5 (7-121)||(29445070-29445184)
chr5 (8-121)||(18336720-18336833)
chr5 (8-121)||(31799640-31799754)
chr5 (6-150)||(4918987-4919133)
chr5 (39-150)||(24074537-24074649)
chr5 (215-312)||(30512360-30512458)
chr5 (215-312)||(30552700-30552798)
chr5 (13-150)||(993755-993890)
chr5 (13-150)||(24650707-24650843)
chr5 (7-121)||(27158990-27159104)
chr5 (37-150)||(20709239-20709355)
chr5 (7-150)||(30512287-30512430)
chr5 (7-150)||(30552627-30552770)
chr5 (26-119)||(41001374-41001465)
chr5 (243-312)||(7126153-7126222)
chr5 (6-143)||(14411908-14412045)
chr5 (193-230)||(20947016-20947053)
chr5 (273-312)||(994012-994051)
chr5 (273-312)||(17762355-17762394)
chr5 (246-312)||(20959330-20959396)
chr5 (273-312)||(41001619-41001658)
chr5 (274-312)||(6817388-6817426)
chr5 (243-312)||(14143974-14144043)
chr5 (243-312)||(24074376-24074445)
chr5 (6-122)||(41424514-41424631)
chr5 (6-70)||(41425768-41425832)
chr5 (277-312)||(4919260-4919295)
chr5 (273-312)||(14411770-14411809)
chr5 (277-312)||(18336541-18336576)
chr5 (7-70)||(28071814-28071877)
chr5 (273-307)||(18336638-18336672)
chr5 (189-230)||(41425710-41425751)
chr5 (272-312)||(20709477-20709517)
chr5 (338-373)||(24837498-24837533)
chr5 (338-373)||(29445134-29445169)
chr5 (190-230)||(41424595-41424635)
[»] chr3 (86 HSPs)
chr3 (7-312)||(14262109-14262415)
chr3 (7-316)||(45969914-45970224)
chr3 (8-312)||(14161871-14162176)
chr3 (6-312)||(14171659-14171966)
chr3 (8-312)||(5800605-5800910)
chr3 (7-312)||(16721990-16722296)
chr3 (7-312)||(30500114-30500419)
chr3 (7-312)||(21632900-21633201)
chr3 (8-312)||(19112838-19113143)
chr3 (7-312)||(35995751-35996054)
chr3 (13-312)||(52552765-52553061)
chr3 (13-312)||(38283555-38283855)
chr3 (6-312)||(20853769-20854075)
chr3 (6-312)||(33372404-33372709)
chr3 (6-308)||(43572387-43572692)
chr3 (6-302)||(49986525-49986823)
chr3 (8-312)||(15328463-15328765)
chr3 (8-312)||(45003496-45003801)
chr3 (6-312)||(9267048-9267354)
chr3 (7-304)||(17465449-17465746)
chr3 (7-220)||(11003731-11003945)
chr3 (94-308)||(4204785-4204999)
chr3 (7-302)||(47575356-47575650)
chr3 (7-150)||(9266974-9267118)
chr3 (7-150)||(14262035-14262179)
chr3 (8-150)||(5800840-5800982)
chr3 (8-150)||(14162106-14162248)
chr3 (7-150)||(14171586-14171729)
chr3 (13-169)||(17649226-17649382)
chr3 (7-150)||(30500042-30500184)
chr3 (6-121)||(16722255-16722371)
chr3 (3-150)||(49986763-49986911)
chr3 (6-150)||(19112762-19112908)
chr3 (7-122)||(20853694-20853811)
chr3 (8-107)||(19720333-19720433)
chr3 (6-150)||(33372640-33372784)
chr3 (26-150)||(45003731-45003855)
chr3 (6-150)||(17465365-17465511)
chr3 (6-122)||(21633159-21633276)
chr3 (9-150)||(52552691-52552835)
chr3 (6-153)||(43572623-43572770)
chr3 (16-150)||(4204717-4204851)
chr3 (243-312)||(14171822-14171891)
chr3 (11-85)||(27946112-27946185)
chr3 (6-150)||(35995676-35995821)
chr3 (7-117)||(45970183-45970295)
chr3 (6-150)||(15328695-15328841)
chr3 (243-312)||(33372479-33372548)
chr3 (7-89)||(35741882-35741963)
chr3 (6-122)||(36990923-36991039)
chr3 (6-122)||(37016363-37016479)
chr3 (8-143)||(35740817-35740951)
chr3 (7-70)||(3424773-3424836)
chr3 (273-312)||(20853962-20854001)
chr3 (273-312)||(43572462-43572501)
chr3 (7-69)||(27946182-27946244)
chr3 (6-59)||(3425975-3426028)
chr3 (75-150)||(38283785-38283861)
chr3 (273-312)||(11003805-11003844)
chr3 (273-312)||(16722064-16722103)
chr3 (273-312)||(45003569-45003608)
chr3 (7-121)||(45058755-45058869)
chr3 (9-83)||(1067715-1067789)
chr3 (243-308)||(14161948-14162013)
chr3 (247-312)||(30500281-30500346)
chr3 (274-312)||(45969988-45970026)
chr3 (274-312)||(49986601-49986639)
chr3 (243-312)||(52552924-52552993)
chr3 (273-313)||(1068915-1068955)
chr3 (273-309)||(21632972-21633008)
chr3 (190-226)||(32998397-32998433)
chr3 (273-312)||(9267241-9267280)
chr3 (273-316)||(17465633-17465676)
chr3 (273-312)||(19113031-19113070)
chr3 (243-308)||(5800682-5800747)
chr3 (243-312)||(14262272-14262341)
chr3 (273-307)||(16722173-16722207)
chr3 (274-312)||(17649277-17649315)
chr3 (7-148)||(32998371-32998511)
chr3 (273-307)||(49986710-49986744)
chr3 (273-310)||(35995944-35995981)
chr3 (190-230)||(4204787-4204827)
chr3 (338-373)||(14161885-14161920)
chr3 (338-373)||(30500369-30500404)
chr3 (190-230)||(43572650-43572690)
chr3 (10-70)||(46850501-46850561)
[»] chr8 (60 HSPs)
chr8 (7-312)||(10108369-10108675)
chr8 (6-312)||(5554867-5555174)
chr8 (7-312)||(26136684-26136990)
chr8 (8-312)||(14820295-14820599)
chr8 (13-303)||(17622969-17623259)
chr8 (7-312)||(21148010-21148315)
chr8 (7-312)||(30789580-30789886)
chr8 (6-316)||(7689522-7689832)
chr8 (13-312)||(42605760-42606058)
chr8 (8-316)||(2583320-2583629)
chr8 (8-312)||(14767580-14767882)
chr8 (36-310)||(22494417-22494687)
chr8 (7-308)||(42113061-42113360)
chr8 (104-312)||(43851737-43851945)
chr8 (7-293)||(43481406-43481694)
chr8 (148-312)||(26532856-26533020)
chr8 (7-150)||(14820529-14820673)
chr8 (7-150)||(10108605-10108749)
chr8 (7-150)||(21147935-21148080)
chr8 (7-121)||(5555133-5555248)
chr8 (7-150)||(7689758-7689902)
chr8 (8-150)||(43851665-43851807)
chr8 (26-169)||(21144721-21144865)
chr8 (16-150)||(42112993-42113127)
chr8 (19-150)||(30789519-30789650)
chr8 (5-143)||(17622887-17623023)
chr8 (6-143)||(10171385-10171523)
chr8 (6-119)||(42606019-42606133)
chr8 (243-312)||(30789743-30789812)
chr8 (6-150)||(2583555-2583701)
chr8 (6-150)||(14767504-14767650)
chr8 (7-70)||(20877061-20877124)
chr8 (37-150)||(26532811-26532926)
chr8 (7-90)||(40486628-40486710)
chr8 (243-312)||(10108443-10108512)
chr8 (8-70)||(18044143-18044205)
chr8 (13-150)||(22494619-22494756)
chr8 (6-83)||(1949650-1949726)
chr8 (7-122)||(28977618-28977734)
chr8 (6-70)||(35367408-35367472)
chr8 (7-122)||(38726686-38726802)
chr8 (6-70)||(40487730-40487794)
chr8 (273-312)||(14820367-14820406)
chr8 (181-304)||(22848399-22848522)
chr8 (7-150)||(26136920-26137063)
chr8 (274-316)||(43481581-43481623)
chr8 (273-310)||(7689598-7689635)
chr8 (6-122)||(20875696-20875811)
chr8 (273-312)||(5554942-5554981)
chr8 (273-312)||(10171409-10171448)
chr8 (243-312)||(17623123-17623192)
chr8 (273-312)||(42605826-42605865)
chr8 (243-312)||(2583393-2583462)
chr8 (273-307)||(17623049-17623083)
chr8 (279-312)||(38726760-38726793)
chr8 (7-119)||(39889628-39889741)
chr8 (9-89)||(21144575-21144655)
chr8 (194-230)||(21144764-21144800)
chr8 (272-312)||(22494458-22494498)
chr8 (9-69)||(39888482-39888542)
[»] chr7 (73 HSPs)
chr7 (7-312)||(41600031-41600337)
chr7 (6-312)||(12006613-12006920)
chr7 (8-312)||(23704662-23704966)
chr7 (6-312)||(20458764-20459070)
chr7 (6-312)||(23383573-23383880)
chr7 (8-312)||(20419609-20419915)
chr7 (6-312)||(20963568-20963873)
chr7 (6-312)||(48672352-48672659)
chr7 (8-312)||(38879797-38880099)
chr7 (13-316)||(1250275-1250579)
chr7 (5-312)||(28218252-28218544)
chr7 (77-302)||(31851322-31851548)
chr7 (79-312)||(44816908-44817142)
chr7 (13-308)||(7658048-7658338)
chr7 (21-312)||(10409388-10409679)
chr7 (8-230)||(6465855-6466077)
chr7 (111-302)||(33162639-33162830)
chr7 (6-194)||(25772523-25772711)
chr7 (13-180)||(48648434-48648600)
chr7 (8-150)||(20419536-20419679)
chr7 (6-150)||(23704896-23705040)
chr7 (7-150)||(25772363-25772506)
chr7 (7-149)||(28218177-28218321)
chr7 (157-312)||(24194941-24195101)
chr7 (194-312)||(25772436-25772554)
chr7 (190-312)||(48648334-48648456)
chr7 (8-150)||(38879723-38879867)
chr7 (6-150)||(12006539-12006683)
chr7 (7-150)||(10409609-10409752)
chr7 (8-150)||(23383499-23383643)
chr7 (6-150)||(48672275-48672422)
chr7 (40-150)||(24195031-24195142)
chr7 (8-155)||(16995200-16995347)
chr7 (6-150)||(20458690-20458834)
chr7 (13-149)||(7657974-7658113)
chr7 (26-150)||(44816851-44816978)
chr7 (243-312)||(12006776-12006845)
chr7 (243-312)||(16995272-16995341)
chr7 (243-312)||(41600194-41600263)
chr7 (243-312)||(48672515-48672584)
chr7 (3-150)||(41599953-41600101)
chr7 (7-89)||(6466102-6466184)
chr7 (243-312)||(28218399-28218468)
chr7 (13-122)||(48648267-48648376)
chr7 (243-312)||(7658205-7658274)
chr7 (273-312)||(23704734-23704773)
chr7 (273-312)||(38879990-38880029)
chr7 (5-70)||(14646966-14647031)
chr7 (8-89)||(14800953-14801033)
chr7 (8-89)||(15247945-15248025)
chr7 (6-122)||(33131631-33131748)
chr7 (8-150)||(20963494-20963638)
chr7 (273-312)||(20419802-20419841)
chr7 (273-312)||(20458957-20458996)
chr7 (8-99)||(23274925-23275016)
chr7 (8-59)||(24195199-24195250)
chr7 (273-312)||(25772597-25772636)
chr7 (13-150)||(31851246-31851382)
chr7 (7-70)||(31852146-31852209)
chr7 (270-312)||(20963757-20963799)
chr7 (9-83)||(23258228-23258301)
chr7 (274-312)||(31851506-31851544)
chr7 (273-312)||(1250472-1250511)
chr7 (273-312)||(23383766-23383805)
chr7 (273-307)||(23704843-23704877)
chr7 (273-302)||(6465937-6465966)
chr7 (7-150)||(33162770-33162915)
chr7 (338-373)||(1250535-1250570)
chr7 (190-226)||(7842518-7842554)
chr7 (6-70)||(14630334-14630398)
chr7 (6-70)||(14795548-14795612)
chr7 (6-70)||(15242540-15242604)
chr7 (273-312)||(24194936-24194976)
[»] chr1 (73 HSPs)
chr1 (8-308)||(48071961-48072262)
chr1 (13-312)||(17606309-17606613)
chr1 (7-312)||(33628763-33629069)
chr1 (27-312)||(4907035-4907321)
chr1 (8-312)||(39711074-39711377)
chr1 (8-312)||(39826123-39826424)
chr1 (7-312)||(24467628-24467932)
chr1 (7-312)||(30299231-30299536)
chr1 (13-312)||(43539352-43539652)
chr1 (6-312)||(29696563-29696863)
chr1 (7-312)||(18462285-18462589)
chr1 (2-312)||(39970719-39971030)
chr1 (7-308)||(52058088-52058387)
chr1 (9-312)||(42510087-42510392)
chr1 (8-312)||(8292804-8293112)
chr1 (92-312)||(20995754-20995973)
chr1 (92-300)||(13229817-13230024)
chr1 (8-194)||(34749297-34749483)
chr1 (189-312)||(34749210-34749333)
chr1 (7-150)||(39711307-39711451)
chr1 (8-150)||(52058011-52058154)
chr1 (7-150)||(17606543-17606685)
chr1 (175-308)||(7473869-7474002)
chr1 (7-150)||(20995903-20996046)
chr1 (8-150)||(42510015-42510157)
chr1 (6-150)||(33628688-33628833)
chr1 (7-150)||(4906961-4907105)
chr1 (7-150)||(39826049-39826193)
chr1 (8-150)||(24467862-24468002)
chr1 (31-194)||(16294138-16294302)
chr1 (7-150)||(34749137-34749280)
chr1 (6-150)||(48072196-48072341)
chr1 (6-122)||(30252161-30252280)
chr1 (7-122)||(8293070-8293187)
chr1 (8-150)||(39970645-39970789)
chr1 (7-149)||(29696794-29696936)
chr1 (13-150)||(18462519-18462657)
chr1 (6-83)||(17500767-17500844)
chr1 (8-150)||(13229966-13230110)
chr1 (7-150)||(43539582-43539726)
chr1 (6-89)||(27039636-27039718)
chr1 (8-122)||(30299494-30299609)
chr1 (243-312)||(39826286-39826351)
chr1 (273-312)||(4907228-4907267)
chr1 (273-312)||(24467701-24467740)
chr1 (10-89)||(26266417-26266496)
chr1 (273-312)||(33628956-33628995)
chr1 (7-89)||(26271182-26271264)
chr1 (8-143)||(18342261-18342395)
chr1 (6-89)||(16294047-16294129)
chr1 (8-122)||(17501993-17502107)
chr1 (246-312)||(17606381-17606447)
chr1 (273-312)||(18462358-18462397)
chr1 (6-89)||(43400751-43400834)
chr1 (273-308)||(52058274-52058309)
chr1 (274-312)||(30299304-30299342)
chr1 (148-251)||(215046-215149)
chr1 (275-312)||(34749373-34749410)
chr1 (190-226)||(17501993-17502029)
chr1 (6-66)||(20995696-20995756)
chr1 (273-312)||(39711145-39711184)
chr1 (273-312)||(39970911-39970950)
chr1 (243-312)||(8292877-8292946)
chr1 (11-69)||(37236721-37236779)
chr1 (273-307)||(42510176-42510210)
chr1 (243-312)||(43539420-43539489)
chr1 (93-194)||(30780256-30780356)
chr1 (273-306)||(34749299-34749332)
chr1 (273-306)||(48072144-48072177)
chr1 (393-439)||(15335301-15335346)
chr1 (190-230)||(24467886-24467926)
chr1 (190-230)||(42510093-42510133)
chr1 (190-230)||(52058090-52058130)
[»] chr2 (63 HSPs)
chr2 (7-308)||(19251470-19251771)
chr2 (13-312)||(26560627-26560928)
chr2 (7-312)||(22263264-22263572)
chr2 (8-312)||(42670792-42671097)
chr2 (8-312)||(15106067-15106372)
chr2 (7-307)||(39878102-39878402)
chr2 (7-312)||(17850659-17850965)
chr2 (6-312)||(20498745-20499050)
chr2 (104-312)||(23806049-23806257)
chr2 (19-312)||(26135828-26136122)
chr2 (19-312)||(17463103-17463396)
chr2 (43-251)||(23854800-23855008)
chr2 (6-312)||(33290047-33290354)
chr2 (8-309)||(13284484-13284791)
chr2 (6-194)||(26236125-26236313)
chr2 (190-312)||(30390532-30390654)
chr2 (190-312)||(26236278-26236400)
chr2 (8-150)||(23806187-23806330)
chr2 (6-150)||(19251705-19251849)
chr2 (8-116)||(23854688-23854797)
chr2 (13-143)||(13254678-13254809)
chr2 (8-150)||(17850587-17850729)
chr2 (7-122)||(17463354-17463470)
chr2 (7-150)||(26236330-26236473)
chr2 (6-150)||(26560554-26560697)
chr2 (8-150)||(22263192-22263334)
chr2 (13-122)||(30390464-30390574)
chr2 (6-150)||(20498980-20499125)
chr2 (8-121)||(42670717-42670833)
chr2 (8-150)||(15106302-15106443)
chr2 (8-143)||(34548574-34548709)
chr2 (209-304)||(13254638-13254733)
chr2 (6-145)||(13254495-13254635)
chr2 (243-312)||(17850822-17850891)
chr2 (8-150)||(26136052-26136195)
chr2 (7-102)||(30959955-30960050)
chr2 (7-121)||(33290313-33290426)
chr2 (7-89)||(12419020-12419101)
chr2 (7-89)||(12431080-12431161)
chr2 (8-84)||(30958684-30958759)
chr2 (243-312)||(22263427-22263496)
chr2 (5-70)||(13284409-13284474)
chr2 (6-109)||(23046705-23046809)
chr2 (273-312)||(19251543-19251582)
chr2 (273-312)||(26135890-26135929)
chr2 (273-312)||(26236200-26236239)
chr2 (11-90)||(34548721-34548799)
chr2 (243-312)||(15106140-15106209)
chr2 (276-312)||(23854761-23854797)
chr2 (273-312)||(13284674-13284713)
chr2 (273-312)||(17463164-17463203)
chr2 (273-312)||(23806025-23806064)
chr2 (8-55)||(23855025-23855072)
chr2 (190-229)||(26236355-26236394)
chr2 (7-90)||(28416171-28416252)
chr2 (243-312)||(23854902-23854971)
chr2 (243-303)||(39878184-39878244)
chr2 (243-308)||(42670955-42671020)
chr2 (275-312)||(13254570-13254607)
chr2 (279-308)||(23046784-23046813)
chr2 (279-308)||(44098894-44098923)
chr2 (190-230)||(13284487-13284527)
chr2 (6-70)||(23047898-23047962)
[»] chr6 (47 HSPs)
chr6 (8-312)||(9481182-9481487)
chr6 (13-312)||(26385351-26385647)
chr6 (5-312)||(24731932-24732243)
chr6 (7-312)||(30617966-30618266)
chr6 (31-258)||(3229990-3230217)
chr6 (7-194)||(32017696-32017882)
chr6 (6-307)||(2299389-2299693)
chr6 (8-306)||(10321809-10322108)
chr6 (18-308)||(30458978-30459267)
chr6 (138-312)||(33714560-33714734)
chr6 (7-312)||(14680955-14681261)
chr6 (157-312)||(18500387-18500543)
chr6 (189-302)||(32017619-32017732)
chr6 (7-150)||(24732173-24732316)
chr6 (72-194)||(33637623-33637746)
chr6 (7-150)||(18500314-18500457)
chr6 (190-310)||(33637710-33637831)
chr6 (5-117)||(9154876-9154990)
chr6 (7-150)||(9854122-9854264)
chr6 (8-143)||(26385278-26385414)
chr6 (13-131)||(19284134-19284253)
chr6 (104-225)||(18500506-18500628)
chr6 (19-150)||(33714494-33714630)
chr6 (148-225)||(17142798-17142875)
chr6 (238-312)||(9854118-9854192)
chr6 (7-150)||(32017540-32017679)
chr6 (243-316)||(10321967-10322040)
chr6 (6-70)||(21070853-21070917)
chr6 (273-312)||(19284202-19284241)
chr6 (2-150)||(14680879-14681025)
chr6 (8-119)||(21069514-21069627)
chr6 (13-150)||(10321738-10321873)
chr6 (6-74)||(18500642-18500709)
chr6 (52-150)||(9481417-9481516)
chr6 (273-312)||(24732011-24732050)
chr6 (13-150)||(30458905-30459044)
chr6 (273-312)||(32017770-32017809)
chr6 (278-312)||(2299580-2299614)
chr6 (275-312)||(9154953-9154990)
chr6 (273-312)||(30618035-30618074)
chr6 (243-308)||(9481259-9481324)
chr6 (21-109)||(15942412-15942502)
chr6 (274-308)||(17142754-17142788)
chr6 (273-307)||(17142800-17142834)
chr6 (273-307)||(26385440-26385474)
chr6 (8-85)||(15941303-15941380)
chr6 (10-70)||(34113582-34113641)
[»] scaffold0361 (4 HSPs)
scaffold0361 (7-312)||(4561-4868)
scaffold0361 (6-150)||(4798-4942)
scaffold0361 (273-316)||(4632-4675)
scaffold0361 (273-307)||(4745-4779)
[»] scaffold0809 (3 HSPs)
scaffold0809 (7-308)||(1410-1711)
scaffold0809 (7-150)||(1645-1785)
scaffold0809 (273-308)||(1487-1522)
[»] scaffold0141 (2 HSPs)
scaffold0141 (6-312)||(8323-8627)
scaffold0141 (20-150)||(8557-8688)
[»] scaffold0185 (2 HSPs)
scaffold0185 (31-308)||(3946-4224)
scaffold0185 (6-148)||(3867-4010)
[»] scaffold0881 (2 HSPs)
scaffold0881 (7-300)||(305-596)
scaffold0881 (1-150)||(212-363)
[»] scaffold0176 (2 HSPs)
scaffold0176 (6-221)||(15797-16008)
scaffold0176 (243-312)||(15868-15937)
[»] scaffold0117 (2 HSPs)
scaffold0117 (11-150)||(12217-12357)
scaffold0117 (243-312)||(12218-12287)
[»] scaffold0449 (4 HSPs)
scaffold0449 (7-194)||(7390-7579)
scaffold0449 (13-122)||(7231-7341)
scaffold0449 (189-312)||(7299-7427)
scaffold0449 (274-312)||(7466-7504)
[»] scaffold0477 (3 HSPs)
scaffold0477 (194-312)||(4934-5053)
scaffold0477 (6-59)||(4878-4931)
scaffold0477 (7-143)||(4990-5125)
[»] scaffold0352 (3 HSPs)
scaffold0352 (6-122)||(5941-6059)
scaffold0352 (6-121)||(4665-4781)
scaffold0352 (273-308)||(4744-4779)
[»] scaffold0157 (1 HSPs)
scaffold0157 (7-99)||(186-281)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 85)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 9396704 - 9397004
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||||||||||| |||||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||||||||| |||||||||| ||  ||||| |    
9396704 aatacctcttttcgtccctgtaatattagcgaatttcgattttagtctctgttaaaaaaaagatttagattttgtccctataatttcaaatttttccact 9396803  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||    
9396804 tttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctcccacttttgatccctgtaatttcatattcctc 9396903  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||| |||| ||||||||| |||| |||||  | ||||  || ||||||||||||||||||||||||||||||||||||    
9396904 cacttttggtccctcattttacgtgtcatgtatgcagattctgctgacgtgttggaatgatggtccaaaagtggaagaatctgaaattacagggacaaaa 9397003  T
312 t 312  Q
    |    
9397004 t 9397004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 308
Target Start/End: Original strand, 15640716 - 15641016
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    ||||||| ||||||||| |||||||||| |||||||||||||| |||||||  |||||||||| |||||||||||||||||| | ||||||||||| |||    
15640716 gggttaacacctcttttcgtccctgtaatattagcgaattccggttttagttcctgtaaaaaa-aagatttagattttgtccctgtaatttcatattctt 15640814  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
     || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||    
15640815 tcacttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaatttcagattcctcccacttttgatccttgtaatttcagat 15640914  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| |||| |||| |||||||||||| |||| ||||| ||| |||| |||||| ||||||  | ||||||||||||||||||||||||||||||||    
15640915 tcctccacttttggtccatcattttacgtgtcatgtatgcatattctgctgacgtggtgaaatgaggaaccaaaagtggaagaatctgaaattacaggga 15641014  T
307 ca 308  Q
    ||    
15641015 ca 15641016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 13 - 310
Target Start/End: Original strand, 3018016 - 3018315
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataa-gatttagattttgtcc-tataatttcatatgcttccat 110  Q
    |||||||||||| |||||||||| |||||||||||||| |||||||| | |||||||| || |||||||||||||||| | ||||||||||| ||||||     
3018016 aatacctcttttcgtccctgtaatattagcgaattccggttttagtcccggtaaaaaaaaaagatttagattttgtccctgtaatttcatattcttccac 3018115  T
111 ttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcct 210  Q
    |||||||||||||||||||||| |||||||||| ||||||||||||| || |||||||| | |||||||||||||||| ||||| |||||||| ||||||    
3018116 ttttggtccctcctttcatcacgtcagcagaatctgcataaattacggccttgtaatttcacattcctcccacttttggtccctataatttcaaattcct 3018215  T
211 ccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaa 310  Q
    ||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | |||   ||||||||||||| |||||||||||||||| |||||||    
3018216 ccacttttggtccctcattttacgtgtcatgtatgcagattatgctgacgtggtggaataagggaccaaaagtggtagaatctgaaattacacggacaaa 3018315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 46046802 - 46046497
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| ||||||| |||| |||||||||| |||||||||||||| |||||||| ||||||| || |||||||||||||||||| | |||||||| || ||    
46046802 agggtaaatacct-ttttcgtccctgtaatattagcgaattccggttttagtccctgtaaataaaaagatttagattttgtccctgtaatttcagattct 46046704  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| ||||| |||||||||||||||| |||||| ||| ||||| |||||||||| |||||||| | |||||||||||||||| ||||||||||||||||    
46046703 tccacttttgatccctcctttcatcacgtcagcaaaatctgcatcaattacgtccttgtaatttcagattcctcccacttttggtccctgtaatttcaga 46046604  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| ||||  |||||||||||||||| |||| ||||||||| | ||||||||| | ||||  ||| ||||||||||||||| |||||||||||||    
46046603 ttcctccacttttgatccctcattttacgtgccatgtatgcagattctactaacgtggtggaatgagggatcaaaagtggaagaatatgaaattacaggg 46046504  T
306 acaaaat 312  Q
    |||||||    
46046503 acaaaat 46046497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 8 - 312
Target Start/End: Complemental strand, 9516988 - 9516683
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||| ||||||| |||||||||| ||||||||||| || ||||||||||||||||||| |||||||||||||||||| | |||||||| || |||    
9516988 gggtaaatatctcttttcgtccctgtaatattagcgaatttcggttttagtctctgtaaaaaaaaagatttagattttgtccctgtaatttcagattctt 9516889  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    | | |||||||||||||||||||||  ||| || ||| | |||||||||||||| |||||||| | |||||||||||||||| |||||||||||||||||    
9516888 ctacttttggtccctcctttcatcaagtcaacaaaatctacataaattacgtccttgtaatttcagattcctcccacttttggtccctgtaatttcagat 9516789  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| |||| ||||||||||||||||  |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||| |||    
9516788 tcctccacttttggtccctcattttacgtatcatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattacaagga 9516689  T
307 caaaat 312  Q
    ||||||    
9516688 caaaat 9516683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 6 - 302
Target Start/End: Complemental strand, 13132319 - 13132024
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| ||||||| |||| |||||||||| ||||||||||| ||||||||||| |||||||||| |||||||||||| ||||| | ||||||||||| |    
13132319 tagggtaaatacctattttcgtccctgtaatattagcgaatttcgattttagtc-ctgtaaaaaa-aagatttagattctgtccctgtaatttcatattc 13132222  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| ||||||||||| ||||||||| ||||||||||| |||||||||||||||| |||||||| | ||| |||||||||||| ||| |||||||||||    
13132221 ttccacttttggtcccttctttcatcaaatcagcagaatctgcataaattacgtccttgtaatttcatatttctcccacttttggtccatgtaatttcag 13132122  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattaca 302  Q
    ||| ||||| |||||| ||||||||||||||| |||| ||||||||| |||| |||||| ||||||  ||| ||||||||||||||||||||||||||    
13132121 attactccacttttagcccctcattttacgtgtcatgtatgcagattctgctgacgtggtgaaatgagggatcaaaagtggaagaatctgaaattaca 13132024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 38574341 - 38574041
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    ||||||| |||| |||||||||| |||||||||||| | |||||||| ||||||| || |||||||||||||||||| | ||||||||||| |||||| |    
38574341 aataccttttttcgtccctgtaatattagcgaattctggttttagtccctgtaaataaaaagatttagattttgtccctgtaatttcatattcttccact 38574242  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||| ||| || ||| ||||| |||| |||||||||||||| | |||||||||||||||| || ||||||||||| |||||||    
38574241 tttggtccctcctttcatcacgtcaacaaaatctgcatcaattgcgtccctgtaatttcagattcctcccacttttggtctctgtaatttcatattcctc 38574142  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| |||||||||||||| || |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||||||||||||    
38574141 cacttttggtccctcattttacatgccatgtatgcagattctgctgacgtggtggaatgagggaccaaaagtggaagaatatgaaattacagggacaaaa 38574042  T
312 t 312  Q
    |    
38574041 t 38574041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 37013085 - 37012780
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||| ||| |||||||||| |||||||||||| | |||||||| ||||| |||| || ||| ||||||||||| | ||||||||||| ||    
37013085 agggtaaatacctcatttcgtccctgtaatattagcgaattctggttttagtccctgtataaaaaaaaatt-agattttgtccctgtaatttcatattct 37012987  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| |||||||| ||||||||||||| |||||| ||| ||||||||||||||||||||||||| | |||| ||| ||||||| ||| |||||||||| |    
37012986 tccacttttggtcactcctttcatcacgtcagcaaaatctgcataaattacgtccctgtaatttcatattcttcctacttttggtccttgtaatttcaaa 37012887  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | |||   |||||||||||||||||||||||||||||||||    
37012886 ttcctccacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtggtggaataagggaccaaaagtggaagaatctgaaattacaggg 37012787  T
306 acaaaat 312  Q
    |||||||    
37012786 acaaaat 37012780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 9618985 - 9619284
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    ||||||| |||| |||| ||||| |||||||||||||| |||||||| |||||||||  |||||||||||||||||| | |||||||| || |||||| |    
9618985 aatacctattttcgtccatgtaatattagcgaattccggttttagtccctgtaaaaacaaagatttagattttgtccctgtaatttcagattcttccact 9619084  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||  ||| |||||| ||||||||| ||||||||||||||| | |||||||||| ||||| ||||||||||||||||||||||    
9619085 tttggtccctcctttcatcaagtcaacagaatctgcataaat-acgtccctgtaatttcatattcctcccatttttggtccctgtaatttcagattcctc 9619183  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || ||||  |||||| ||||||||| || | || |||||| |||| |||||| | |||| |||||||||||||||||||| |||||||||| ||||||||    
9619184 cacttttgctccctctttttacgtgccaggtatacagattctgcttacgtggtggaatgaaggaccaaaagtggaagaatatgaaattacaaggacaaaa 9619283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 11 - 312
Target Start/End: Complemental strand, 48580241 - 48579939
Alignment:
11 ttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctg-taaaaaataagatttagattttgtcc-tataatttcatatgcttcc 108  Q
    |||||||||||||| |||||||||| |||||||||||||| ||||| || ||| ||||||| | |||||||||||||||| | |||||||||||  ||||    
48580241 ttaatacctcttttcgtccctgtaatattagcgaattccggttttaatc-ctgataaaaaaaacgatttagattttgtccctgtaatttcatattgttcc 48580143  T
109 atttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattc 208  Q
    | |||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||| |||||||||||||||||| || || |||||||| ||||    
48580142 acttttggtccctcctttcatcaccttagcagaatatgcataaattacgtccttgtaatttcaaattcctcccacttttggtctctctaatttcaaattc 48580043  T
209 ctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggaca 308  Q
    ||||| ||||  |||||||||||||||| |||| ||| ||||| |||| |||||| | |||   ||||||||| || |||||||||||||||||| ||||    
48580042 ctccacttttgctccctcattttacgtgccatgtatgtagattctgctgacgtggtggaataagggaccaaaattgaaagaatctgaaattacagagaca 48579943  T
309 aaat 312  Q
    ||||    
48579942 aaat 48579939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 31090440 - 31090134
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||| ||||||| |||||||||| ||||||||||| ||||||||||| |||||||||| || | ||||||||||||| | |||||||| || ||    
31090440 agggtaaatatctcttttcgtccctgtaatattagcgaatttcgattttagtccctgtaaaaaaaaaaaattagattttgtccctgtaatttcagattct 31090341  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    || | |||||||||||||||||||||  |||  ||||| | |||||||||||||| |||||||| | ||| |||||||||||| |||| |||||||||||    
31090340 tctacttttggtccctcctttcatcaagtcaatagaatctacataaattacgtccttgtaatttcagatttctcccacttttggtccccgtaatttcaga 31090241  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| |||| |||||||||||  |||| ||||| ||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||||||    
31090240 ttcctccacttttggtccttcattttacgtaccatgtatgcaaattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattacaggg 31090141  T
306 acaaaat 312  Q
    |||||||    
31090140 acaaaat 31090134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 7819020 - 7819319
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||||||||||| | || | ||| |||||||||||||| ||||||||  |||||| || |||||||||||||||||| | |||||||| || |||||| |    
7819020 aatacctcttttcgaccatataatattagcgaattccggttttagtca-tgtaaataaaaagatttagattttgtccctgtaatttcagattcttccact 7819118  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    |||||| |||||||||||||| | || | ||| ||||| |||||||||| |||||||| | |||||||||||||||| ||| |||||||||| |||||||    
7819119 tttggttcctcctttcatcacgttagtaaaatctgcatcaattacgtccatgtaatttcagattcctcccacttttggtccatgtaatttcatattcctc 7819218  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||||||| |||||||||||||||    
7819219 cacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtggtggaatgagggaccaaaagtggaagaatctgacattacagggacaaaa 7819318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 26 - 312
Target Start/End: Complemental strand, 34064342 - 34064055
Alignment:
26 gtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttccatttttggtccctcct 124  Q
    |||| ||||| |||||  |||| || ||||| | ||||||||| | ||||||||||||||||| || |||||||| || |||||| ||||||||||| ||    
34064342 gtccatgtaatattagtaaatttcggttttaatttctgtaaaataaaagatttagattttgtctctgtaatttcagattcttccacttttggtcccttct 34064243  T
125 ttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatttttagtccc 224  Q
    |||||||| |||||||||| |||||||||||||||| |||||||| | |||||||| ||||||| |||||||||||||||||||||||| ||||||||||    
34064242 ttcatcacgtcagcagaatctgcataaattacgtccttgtaatttcagattcctcctacttttggtccctgtaatttcagattcctccacttttagtccc 34064143  T
225 tcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| || |||| ||| |||||  ||| | |||| | ||||  ||||||||||||||||||||||||||||||| ||||||||    
34064142 tcattttacatgccatgtatgtagattcggctgatgtggtggaatgagggaccaaaagtggaagaatctgaaattacagagacaaaat 34064055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 4355887 - 4356186
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    ||||||||||||||| | | ||| |||||||||||||| |||||||  |||||||||  ||| |||||||||||||  | ||||||||||| ||| || |    
4355887 aatacctctttttgttcatataatattagcgaattccggttttagttcctgtaaaaac-aagctttagattttgtctatgtaatttcatattctttcact 4355985  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||| ||||||||| | |||||||| |||||||||||||||| |||||||| | |||||||| ||||||| ||| |||||||||| |||||||    
4355986 tttggtccctcatttcatcacgttagcagaatctgcataaattacgtccttgtaatttcagattcctcctacttttggtccttgtaatttcaaattcctc 4356085  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | |||   ||||||||||||||||||| ||||||||||| |||||||    
4356086 cacttttggtccctcattttacgtgtcatgtatgcagattctgctgacgtggtggaataagggaccaaaagtggaagaatttgaaattacagagacaaaa 4356185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 18 - 312
Target Start/End: Original strand, 31943959 - 31944255
Alignment:
18 ctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaa-aaataagatttagattttgtcc-tataatttcatatgcttccatttttg 115  Q
    ||||||| |||||||||| |||||||||||||| |||||||  ||||||| ||| |||||||||||||||||| | ||||||||||| |||||| |||||    
31943959 ctcttttcgtccctgtaatattagcgaattccggttttagttcctgtaaataaaaaagatttagattttgtccctgtaatttcatattcttccacttttg 31944058  T
116 gtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatt 215  Q
    ||| ||||||||||||| ||| || ||  ||||| ||||| |||| |||||||| | |||||||||||||||| ||| |||||||||||||||||||| |    
31944059 gtctctcctttcatcacgtcaacaaaacctgcatcaattatgtccatgtaatttcagattcctcccacttttggtccatgtaatttcagattcctccact 31944158  T
216 tttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||| ||||||||||||||||| || | ||||||||| || | |||||| | ||||  |||| |||||||||||||| |||||||||| |||||||||    
31944159 tttggtccctcattttacgtgccaagtatgcagattctgttgacgtggtggaatgagggacaaaaagtggaagaatatgaaattacatggacaaaat 31944255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 6 - 312
Target Start/End: Original strand, 3273619 - 3273925
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatt-tagattttgtcc-tataatttcatatg 103  Q
    |||||| |||| ||||||| |||||||||| ||||||||||||||||||||||| | ||||    |    || |||||||||||| | |||||||||||     
3273619 tagggtaaatatctcttttcgtccctgtaatattagcgaattccgattttagtccccgtaatttttttttttatagattttgtccctgtaatttcatatt 3273718  T
104 cttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttca 203  Q
    |||||| |||||||||||||||||||||  |||  ||||| |||||||||||||||| |||||||| | |||||||||||||||| | ||||||||||||    
3273719 cttccacttttggtccctcctttcatcaagtcattagaatctgcataaattacgtccttgtaatttcatattcctcccacttttggt-cctgtaatttca 3273817  T
204 gattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacag 303  Q
    |||| |||||  ||| || |||||||||||||| |||| ||||||||| | || |||||| ||||||  ||| |||||||||||||||||||||||||||    
3273818 gattactccacgtttggt-cctcattttacgtgccatgtatgcagattctactgacgtggtgaaatgagggatcaaaagtggaagaatctgaaattacag 3273916  T
304 ggacaaaat 312  Q
    ||| |||||    
3273917 ggataaaat 3273925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 51 - 312
Target Start/End: Original strand, 18713003 - 18713265
Alignment:
51 attttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatttttggtccctcctttcatcacatcagcagaatatgcat 149  Q
    ||||| ||| |||||||||| | |||||||||||||||| | |||||||||||  ||||| |||||||||||||||||||||| |||||| ||| |||||    
18713003 attttcgtccctgtaaaaaaaacgatttagattttgtccctgtaatttcatattgttccaattttggtccctcctttcatcacgtcagcaaaatctgcat 18713102  T
150 aaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatttttagtccctcattttacgtgncatgnatgcaga 249  Q
    |||||||||||||||||||| | ||||||||| |||||| ||| |||||||||| ||||||| | |||| |||||||| |||||||   ||| ||| |||    
18713103 aaattacgtccctgtaatttcagattcctccctcttttggtccatgtaatttcaaattcctcaacttttggtccctcagtttacgttcaatgtatgtaga 18713202  T
250 ttttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    || |||| |||||| | |||   ||||||||| ||||||||||||||||||||| ||||||||    
18713203 ttctgctgacgtggtggaataagggaccaaaactggaagaatctgaaattacagagacaaaat 18713265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 93 - 312
Target Start/End: Original strand, 18667375 - 18667594
Alignment:
93 aatttcatatgcttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatcc 192  Q
    ||||||||||  ||||| |||||||||||||||||||||| ||| || ||| ||||||||||||||||||||||||| | |||||||| ||||||| |||    
18667375 aatttcatattgttccacttttggtccctcctttcatcacgtcaacaaaatctgcataaattacgtccctgtaatttcagattcctccaacttttggtcc 18667474  T
193 ctgtaatttcagattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatc 292  Q
    ||||||||| | ||||||||| |||| ||||||||||||||||| |||| ||||||||| | || |||||| | |||   |||| |||| ||||||||||    
18667475 ctgtaattttaaattcctccacttttggtccctcattttacgtgccatgtatgcagattctactgacgtggtggaataagggacaaaaactggaagaatc 18667574  T
293 tgaaattacagggacaaaat 312  Q
    ||||||||||||| ||||||    
18667575 tgaaattacagggtcaaaat 18667594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 190 - 312
Target Start/End: Original strand, 26252419 - 26252542
Alignment:
190 tccctgtaatttcagattcctcc-atttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaag 288  Q
    ||||||||||||||||||||||| | |||| ||||||||||||||||| |||| ||||||||| |||| |||| | | ||||| ||||||||||||||||    
26252419 tccctgtaatttcagattcctcccacttttggtccctcattttacgtgccatgtatgcagattctgcttacgtagtggaatgggggaccaaaagtggaag 26252518  T
289 aatctgaaattacagggacaaaat 312  Q
    ||| ||||||||||||||||||||    
26252519 aatatgaaattacagggacaaaat 26252542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 157 - 312
Target Start/End: Original strand, 48259901 - 48260056
Alignment:
157 gtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatttttagtccctcattttacgtgncatgnatgcagattttgct 256  Q
    |||| |||||||| | |||||||| ||||||| ||||||| |||||||||||||||| ||||  |||||||||||||||| |||| ||||||||| ||||    
48259901 gtccatgtaatttcagattcctcctacttttggtccctgttatttcagattcctccacttttgatccctcattttacgtgccatgtatgcagattatgct 48260000  T
257 aacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
     |||||  | ||||   || ||||||||||||||| ||||||||||||||||||||    
48260001 gacgtgatggaatgagcgatcaaaagtggaagaatttgaaattacagggacaaaat 48260056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 35376168 - 35376346
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttccatt 111  Q
    ||||||| |||| |||||||||| |||||||||||| | |||||||| |||||||||| ||||||||||||||||| || |||||| | || |||||| |    
35376168 aatacctattttcgtccctgtaatattagcgaattctggttttagtccctgtaaaaaa-aagatttagattttgtctctgtaattttagattcttccact 35376266  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccct 194  Q
    ||||||| ||||||||||||| ||||||||||  |||||||||| |||| |||||    | |||||||||||||||| |||||    
35376267 tttggtctctcctttcatcacgtcagcagaatccgcataaattaagtccatgtaa---cagattcctcccacttttggtccct 35376346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 38573968 - 38574111
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    ||||| |||||||||||| |||| ||||| ||||| |||||||||||||| || |||||||||| |||||||||||||||| ||| ||||||||||| ||    
38573968 agggtaaatacctcttttcgtccatgtaatattagtgaattccgattttaatccctgtaaaaaa-aagatttagattttgtccctgtaatttcatattct 38574066  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| || || ||| |||||||||| ||||||    
38574067 tccacttttggtccctcattccaccacgtcagcagaatctgcata 38574111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 13 - 150
Target Start/End: Original strand, 9516615 - 9516753
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||| ||||||| |||||||||| |||||||||||||| ||||||||  ||||||||| |||||||||||||||||| | ||||||||||| |||||| |    
9516615 aatatctcttttcgtccctgtaatattagcgaattccggttttagtccttgtaaaaaaaaagatttagattttgtccttgtaatttcatattcttccact 9516714  T
112 tttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||||||||| || || ||| | |||||||| ||||||    
9516715 tttggtccctcattccaccacgtaagcagaatctgcata 9516753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 77 - 194
Target Start/End: Original strand, 26252337 - 26252455
Alignment:
77 ttagattttgtcc-tataatttcatatgcttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaatt 175  Q
    ||||||||||||| | |||||||| || |||||| |||||||||||||||||||||  ||| |||||| ||||||||||||||||||||||||| | |||    
26252337 ttagattttgtccctgtaatttcagattcttccacttttggtccctcctttcatcaagtcaacagaatctgcataaattacgtccctgtaatttcagatt 26252436  T
176 cctcccacttttgatccct 194  Q
    ||||||||||||| |||||    
26252437 cctcccacttttggtccct 26252455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 202 - 316
Target Start/End: Original strand, 35376322 - 35376437
Alignment:
202 cagattcctcc-atttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaatta 300  Q
    ||||||||||| | |||| ||||||||||||||||| |||| || ||||||||||| |||||| | ||||  ||||||||||||||||| ||||||||||    
35376322 cagattcctcccacttttggtccctcattttacgtgtcatgtatacagattttgctgacgtggtggaatgagggaccaaaagtggaagattctgaaatta 35376421  T
301 cagggacaaaatttaa 316  Q
    ||||||||||||||||    
35376422 cagggacaaaatttaa 35376437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 7 - 119
Target Start/End: Complemental strand, 9619358 - 9619245
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| ||||||||||||||||||||||| |||||||||||| | |||||||| ||||| |||| |||||||||||||||||| | ||||||||||| ||    
9619358 agggtaaatacctctttttgtccctgtaatattagcgaattctggttttagtccctgtagaaaaaaagatttagattttgtccttgtaatttcatattct 9619259  T
106 tccatttttggtcc 119  Q
    |||| |||||||||    
9619258 tccacttttggtcc 9619245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 150
Target Start/End: Original strand, 31090060 - 31090204
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgt-aaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    |||| ||||| ||||||||||||||||| ||||| ||||| ||||||||||| |||| |||||| |||||||||||||||| ||| ||||||||||| ||    
31090060 gggtaaatacttctttttgtccctgtaatattagtgaatttcgattttagtccctgtaaaaaaaaaagatttagattttgtccctgtaatttcatattct 31090159  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| || || ||| | |||||||| ||||||    
31090160 tccacttttggtccctcattccaccacgtaagcagaatttgcata 31090204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 13 - 143
Target Start/End: Original strand, 34063987 - 34064118
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttccatt 111  Q
    |||||||||||| |||||||||| |||| |||||||   |||||||| |||||||||| ||||||||||||||||| || |||||||| || |||||| |    
34063987 aatacctcttttcgtccctgtaatattaacgaattctagttttagtccctgtaaaaaaaaagatttagattttgtctctgtaatttcagattcttccact 34064086  T
112 tttggtccctcctttcatcacatcagcagaat 143  Q
    ||||||||||| || || ||||||||| ||||    
34064087 tttggtccctcattccaccacatcagccgaat 34064118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 41947232 - 41947072
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtccta-taatttcatatgctt 106  Q
    |||| |||| ||||||| |||||||||| ||||||||||| || ||||||||  | ||||||| ||   ||||||||||||||  |||||||||||  ||    
41947232 gggtaaatatctcttttcgtccctgtaatattagcgaatttcggttttagtccttttaaaaaaaaaa--ttagattttgtccttgtaatttcatattttt 41947135  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattt 169  Q
    ||| ||||||||||| ||||||| |  ||| |||||| |||||||||||||||||||||||||    
41947134 ccacttttggtccctgctttcataaagtcaacagaatctgcataaattacgtccctgtaattt 41947072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 6 - 150
Target Start/End: Complemental strand, 9397078 - 9396934
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgc 104  Q
    |||||| ||||| |||||| |||||||||| |||||| ||||||| |||||||| |||||||||| |||||||||||||||| ||| |||||||| || |    
9397078 tagggtaaatacttcttttcgtccctgtaatattagcaaattccggttttagtccctgtaaaaaa-aagatttagattttgtccctgtaatttcagattc 9396980  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||| |||||| || || || || ||| |||||||||| ||||||    
9396979 ttccacttttggaccatcattccaacacgtcagcagaatctgcata 9396934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 26252615 - 26252502
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgctt 106  Q
    |||| |||| ||||||| |||||||||| |||||||||||||  |||||||  |||||||||| |||||||||||||||| ||| ||||||||||| |||    
26252615 gggtaaatatctcttttcgtccctgtaatattagcgaattccagttttagttcctgtaaaaaaaaagatttagattttgtccctgtaatttcatattctt 26252516  T
107 ccatttttggtccc 120  Q
    ||| ||||||||||    
26252515 ccacttttggtccc 26252502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 150
Target Start/End: Original strand, 37012709 - 37012850
Alignment:
10 gttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttcc 108  Q
    ||||||||||||||| |||| ||||| ||||||||||||  |||| ||||  ||||||||| |||||||||||||||| ||| |||||||| || |||||    
37012709 gttaatacctcttttcgtccttgtaatattagcgaattctaatttcagtccttgtaaaaaaaaagatttagattttgtccctgtaatttcagattcttcc 37012808  T
109 atttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    | |||||||||||  || || ||| |||||||||| ||||||    
37012809 acttttggtcccttattccaccacgtcagcagaatctgcata 37012850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 7 - 150
Target Start/End: Complemental strand, 31944329 - 31944185
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| ||||| |||||| |||| ||||| ||||||||||| || ||||||||||||||||||| || | ||||||||||||| | ||||||||||| ||    
31944329 agggtaaatacttcttttcgtccttgtaatattagcgaatttcggttttagtctctgtaaaaaaaaataattagattttgtccatgtaatttcatattct 31944230  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||| ||||||| || || ||| ||| |||||| ||||||    
31944229 tccactttttgtccctcattccaccacgtcaacagaatctgcata 31944185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 48260123 - 48259986
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttccatt 111  Q
    |||| ||||||| |||||||||| |||||||||||  ||||||| ||||||||||||| |||||||||||||||| ||| |||||||| || |||||| |    
48260123 aatatctcttttcgtccctgtaatattagcgaattttgattttaatctctgtaaaaaa-aagatttagattttgtccctgtaatttcaaattcttccact 48260025  T
112 tttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| || ||| || |||||| |||||| ||| ||||||    
48260024 tttgatcgctcattccatcacgtcagcataatctgcata 48259986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 48579869 - 48580002
Alignment:
11 ttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttcca 109  Q
    |||||||||||||| |||||||||| |||| |||| | || ||||||||| ||||||||| ||||||||||||||||| || |||||||| || ||| ||    
48579869 ttaatacctcttttcgtccctgtaatattaacgaagttcggttttagtctatgtaaaaaaaaagatttagattttgtctctgtaatttcagattctttca 48579968  T
110 tttttggtccctcctttcatcacatcagcagaat 143  Q
     |||||||||||  || || ||| ||||||||||    
48579969 attttggtcccttattccaccacgtcagcagaat 48580002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 15641089 - 15640950
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataa-gatttagattttgtcc-tataatttcatatgcttccat 110  Q
    |||||||||||| |||| ||||| ||||| |||||||| ||||| |  |||||||||| || |||||||||| ||||| | |||||||| || ||||||     
15641089 aatacctcttttcgtccttgtaatattagtgaattccggttttaattcctgtaaaaaaaaaagatttagattatgtccctgtaatttcagattcttccac 15640990  T
111 ttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||||| |||| ||||| ||| |||||||||||||||||    
15640989 ttttggttcctcatttcaccacgtcagcagaatatgcata 15640950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 11 - 150
Target Start/End: Complemental strand, 4356255 - 4356116
Alignment:
11 ttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttcca 109  Q
    ||||||||||||||  ||||||||| ||||||||||| || ||||| ||||||||| ||| || |||| ||||||||| || |||||||| || ||||||    
4356255 ttaatacctcttttcatccctgtaatattagcgaatttcggttttaatctctgtaataaaaaaaattt-gattttgtctctgtaatttcaaattcttcca 4356157  T
110 tttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
     |||||||||||  || || ||| |||||||||| ||||||    
4356156 cttttggtcccttattccaccacgtcagcagaatctgcata 4356116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 150
Target Start/End: Complemental strand, 3273996 - 3273855
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgctt 106  Q
    |||| |||||||||||| ||||| |||| ||||||||||| || |||||||| || ||||||| |||||||||||||| | ||| |||||||| || |||    
3273996 gggtaaatacctcttttcgtccc-gtaatattagcgaatttcggttttagtccctataaaaaa-aagatttagattttatccctgtaatttcagattctt 3273899  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||| ||||| |||||| ||||| ||| |||| ||||| ||||||    
3273898 ccacttttgatccctcatttcaccacgtcagtagaatctgcata 3273855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 6 - 122
Target Start/End: Original strand, 46046428 - 46046539
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgc 104  Q
    |||||| ||||||| |||| |||||||||| ||||||||||||||||||||||| ||||||||||       |||||||||| ||| ||||||||||| |    
46046428 tagggtaaataccttttttcgtccctgtaatattagcgaattccgattttagtccctgtaaaaaa------atagattttgtccctgtaatttcatattc 46046521  T
105 ttccatttttggtccctc 122  Q
    ||||| ||||| ||||||    
46046522 ttccacttttgatccctc 46046539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 48259822 - 48259904
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc 89  Q
    ||||| |||| ||||||| |||||||||| |||||||||||||| ||||| || ||||||| || ||||||||||||||||||    
48259822 agggtaaatatctcttttcgtccctgtaatattagcgaattccggttttaatccctgtaaataaaaagatttagattttgtcc 48259904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 6 - 150
Target Start/End: Complemental strand, 3018390 - 3018247
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    ||||||||||| ||||||| |||||||||| |||| |||||| || |||||||| |||||||||| |||||||||| ||||||| | |||||||| || |    
3018390 tagggttaatatctcttttcgtccctgtaatattaacgaatttcggttttagtccctgtaaaaaa-aagatttaga-tttgtccgtgtaatttcagattc 3018293  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    | ||| |||||||||||  || || ||| |||||| ||| ||||||    
3018292 taccacttttggtcccttattccaccacgtcagcataatctgcata 3018247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 12904746 - 12904857
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||| ||||||| |||||| ||| |||||||||||  | |||||||| |||||||||| || ||||||||||||||| |||||||||| || ||    
12904746 agggtaaatatctcttttcgtccctataatattagcgaattttggttttagtccctgtaaaaaa-aaaatttagattttgtccttataatttcagattct 12904844  T
106 tccatttttggtc 118  Q
    |||| ||||||||    
12904845 tccacttttggtc 12904857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 7819156 - 7819087
Alignment:
243 atgcagattttgctaacgtggngaaatggagga-ccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||| ||||||||  |||| |||||| |||||||||||||||||||||||||||||||||||||    
7819156 atgcagattttactaacgtgatgaaa-ggaggaaccaaaagtggaagaatctgaaattacagggacaaaat 7819087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 13 - 150
Target Start/End: Original strand, 13131945 - 13132084
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgt-aaaaaataagatttagattttg-tcctataatttcatatgcttccat 110  Q
    |||||||||||| |||| ||||| |||| |||||| |  |||||||| |||| |||||| |||||||||||| || || | |||||||| || ||||||     
13131945 aatacctcttttcgtccttgtaatattaacgaatttctgttttagtccctgtaaaaaaaaaagatttagattatgttcatgtaatttcagattcttccac 13132044  T
111 ttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||| |||||| ||||| ||| |||||||||| ||||||    
13132045 ttttgatccctcatttcaccacgtcagcagaatctgcata 13132084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 6 - 77
Target Start/End: Complemental strand, 31218361 - 31218290
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatt 77  Q
    |||||| |||||||||||| |||||||||| |||||||||||||| |||||||| ||||||| || ||||||    
31218361 tagggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaataaaaagatt 31218290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 35376500 - 35376374
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||| ||||||| |||||||||| |||||| ||||||  |||||||| |||||||||| |||||||| ||||||||| | |||||||| |  |||||| |    
35376500 aatatctcttttcgtccctgtaatattagcaaattccagttttagtccctgtaaaaaa-aagatttaaattttgtccctgtaatttcagaatcttccact 35376402  T
112 tttggtccctcctttcatcacatcagca 139  Q
    ||||||||||| || || ||| ||||||    
35376401 tttggtccctcattccaccacgtcagca 35376374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 7 - 143
Target Start/End: Complemental strand, 18713341 - 18713202
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgatttta---gtctctgtaaaaaataagatttagattttgtc-ctataatttcatat 102  Q
    |||||||||||||||||| || ||||||  |||||||| || || |||||   ||| |||||||||| ||||||||||||||||| || |||||||| ||    
18713341 agggttaatacctcttttcgtacctgtattattagcgagtttcggttttagtcgtccctgtaaaaaa-aagatttagattttgtctctgtaatttcagat 18713243  T
103 gcttccatttttggtccctcctttcatcacatcagcagaat 143  Q
     |||||| |||||||||||  || || ||| ||||||||||    
18713242 tcttccagttttggtcccttattccaccacgtcagcagaat 18713202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 46046660 - 46046729
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||| |||||  |||| |  ||| ||||||||||||||||||||||||||||||||||||    
46046660 atgcagattttgctgacgtgatgaaaggagggatcaaaagtggaagaatctgaaattacagggacaaaat 46046729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 36887679 - 36887755
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagatt 83  Q
    |||||||||||||||||| |||||||||| |||||||||||  | |||||||| |||||||||| ||  ||||||||    
36887679 agggttaatacctcttttggtccctgtaatattagcgaattttggttttagtccctgtaaaaaaaaaagtttagatt 36887755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 9619092 - 9619053
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||||||||||||||||||||||||    
9619092 ggaccaaaagtggaagaatctgaaattacagggacaaaat 9619053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 26252380 - 26252341
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||||||||||||||||||||||||    
26252380 ggaccaaaagtggaagaatctgaaattacagggacaaaat 26252341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 37012943 - 37013012
Alignment:
243 atgcagattttgctaacgtggngaaatggag-gaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||| |||||  |||| |||| |||||||||||||||||| ||||||||||||||||||||    
37012943 atgcagattttgctgacgtgatgaaa-ggagtgaccaaaagtggaagaatatgaaattacagggacaaaat 37013012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 3018154 - 3018085
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| |||| |||||  |||| |  ||||||||||||||||||| ||||||||||||||||||||    
3018154 atgcagattctgctgacgtgatgaaaggagggaccaaaagtggaagaatatgaaattacagggacaaaat 3018085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 38574204 - 38574273
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||| | |||||  |||| |  ||||||||||||||||||| ||||||||||||||||||||    
38574204 atgcagattttgttgacgtgatgaaaggagggaccaaaagtggaagaatatgaaattacagggacaaaat 38574273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 120
Target Start/End: Complemental strand, 31083463 - 31083362
Alignment:
20 ctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttccatttttggtc 118  Q
    ||||| |||||||||| || ||||||||||| |||| ||  | ||||||||||| ||||||||||||| ||||| |||| | || |||||| ||||||||    
31083463 cttttcgtccctgtaatatgagcgaattccggttttggttccagtaaaaaataaaatttagattttgtccctatcatttgagattcttccacttttggtc 31083364  T
119 cc 120  Q
    ||    
31083363 cc 31083362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 122
Target Start/End: Original strand, 43312227 - 43312324
Alignment:
26 gtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttccatttttggtccctc 122  Q
    |||||||||| |||||| |||||||||||||||| |||||||||| || ||||| ||| ||| ||| |||||||| || | |||| |||| |||||||    
43312227 gtccctgtaatattagcaaattccgattttagtccctgtaaaaaaaaaaatttaaattctgtccctgtaatttcagattcctccacttttagtccctc 43312324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 50462776 - 50462727
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgatttt 55  Q
    ||||||||||||||||||| |||||||||| ||||||||||||| |||||    
50462776 tagggttaatacctcttttggtccctgtaatattagcgaattccaatttt 50462727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 41946964 - 41947043
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc 89  Q
    ||||| |||||||||||| |||||||||| ||||| |||||||| |||||||| ||| |||||| ||   |||||||||||||    
41946964 agggtaaatacctcttttcgtccctgtaatattagtgaattccggttttagtccctgcaaaaaaaaa---ttagattttgtcc 41947043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 53896445 - 53896520
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagatt 83  Q
    ||||||||||||||||||  || |||||| || ||||||||||| |||||||| |||||||||| ||| ||||||||    
53896445 agggttaatacctcttttgatcgctgtaatatgagcgaattccggttttagtccctgtaaaaaaaaag-tttagatt 53896520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 3273734 - 3273695
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||| ||||||||||||||||||||    
3273734 ggaccaaaagtggaagaatatgaaattacagggacaaaat 3273695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 9516876 - 9516915
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||| ||||||||||||||||||||||||||||    
9516876 ggaccaaaagtagaagaatctgaaattacagggacaaaat 9516915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 18667669 - 18667606
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaa 70  Q
    |||||||||||||||||| |||||||||| |||||||||||||  ||||| ||  |||||||||    
18667669 agggttaatacctcttttcgtccctgtaatattagcgaattccagttttaatccttgtaaaaaa 18667606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 31090327 - 31090366
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||| ||||||||||||||||||||||||||||    
31090327 ggaccaaaagtagaagaatctgaaattacagggacaaaat 31090366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 34064248 - 34064287
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||||||||||||||| ||||||||    
34064248 ggaccaaaagtggaagaatctgaaattacagagacaaaat 34064287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 43313589 - 43313515
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagatt 83  Q
    ||||||||||| ||||| ||| |||||| |||||||||||| | |||||||| |||||||||| ||| ||||||||    
43313589 gggttaataccacttttggtctctgtaatattagcgaattctggttttagtccctgtaaaaaaaaag-tttagatt 43313515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 4356023 - 4355954
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| ||||||||||  ||||||  |||||||||||| |||||| ||||||||||  ||||||||    
4356023 atgcagattctgctaacgtgatgaaatgagggaccaaaagtgaaagaatatgaaattacatagacaaaat 4355954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 12904939 - 12904881
Alignment:
31 tgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc 89  Q
    ||||| |||||||||||  |||||||||| |||||||||| |||||||| |||||||||    
12904939 tgtaatattagcgaattttgattttagtccctgtaaaaaaaaagatttaaattttgtcc 12904881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 18713102 - 18713033
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||| |||||  |||| |  ||||||||| ||||| ||| ||||||||||||||||||||    
18713102 atgcagattttgctgacgtgatgaaaggagggaccaaaattggaacaatatgaaattacagggacaaaat 18713033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 274 - 312
Target Start/End: Complemental strand, 31944061 - 31944023
Alignment:
274 gaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||| ||||||||||||||||||||    
31944061 gaccaaaagtggaagaatatgaaattacagggacaaaat 31944023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 36889057 - 36888943
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    |||||||||||| ||||| |||||| ||| |||||||||||  | |||||||| |||||||||| || ||||||||| ||| ||| |||||||| || |     
36889057 agggttaataccacttttggtccctataatattagcgaattttggttttagtc-ctgtaaaaaa-aaaatttagattatgtccctgtaatttcagattcc 36888960  T
106 tccatttttggtccctc 122  Q
    |||| |||| |||||||    
36888959 tccacttttagtccctc 36888943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 190 - 226
Target Start/End: Complemental strand, 36888979 - 36888943
Alignment:
190 tccctgtaatttcagattcctccatttttagtccctc 226  Q
    |||||||||||||||||||||||| ||||||||||||    
36888979 tccctgtaatttcagattcctccacttttagtccctc 36888943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 43312288 - 43312324
Alignment:
190 tccctgtaatttcagattcctccatttttagtccctc 226  Q
    |||||||||||||||||||||||| ||||||||||||    
43312288 tccctgtaatttcagattcctccacttttagtccctc 43312324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 46935218 - 46935170
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgatttt 55  Q
    |||||||||||||||||| |||||| ||| ||||||||||| |||||||    
46935218 agggttaatacctcttttggtccctataatattagcgaatttcgatttt 46935170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 308
Target Start/End: Original strand, 13132207 - 13132242
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggaca 308  Q
    ||||||||||||||||||| ||||||||||||||||    
13132207 ggaccaaaagtggaagaatatgaaattacagggaca 13132242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 15640827 - 15640788
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||| |||||| ||||||||||||||||||||    
15640827 ggaccaaaagtgaaagaatatgaaattacagggacaaaat 15640788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 316
Target Start/End: Complemental strand, 43312321 - 43312278
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaatttaa 316  Q
    |||| ||||||||| ||||||||||||||||||||| |||||||    
43312321 ggactaaaagtggaggaatctgaaattacagggacagaatttaa 43312278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 48580132 - 48580171
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||| ||| ||||||||||||||||||||    
48580132 ggaccaaaagtggaacaatatgaaattacagggacaaaat 48580171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 9396841 - 9396772
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| |||| |||||  |||| |  ||||||||||||||| ||| |||||||| |||||||||||    
9396841 atgcagattctgctgacgtgatgaaaggagggaccaaaagtggaaaaatttgaaattatagggacaaaat 9396772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 273 - 307
Target Start/End: Original strand, 9516772 - 9516806
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggac 307  Q
    |||||||||||||| ||||||||||||||||||||    
9516772 ggaccaaaagtggaggaatctgaaattacagggac 9516806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 274 - 312
Target Start/End: Complemental strand, 12904857 - 12904819
Alignment:
274 gaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||||||||||| | |||||||||    
12904857 gaccaaaagtggaagaatctgaaattataaggacaaaat 12904819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 274 - 312
Target Start/End: Complemental strand, 35376273 - 35376235
Alignment:
274 gaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||||| ||||||||| ||||||||    
35376273 gaccaaaagtggaagaatctaaaattacagagacaaaat 35376235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 307
Target Start/End: Original strand, 31090216 - 31090257
Alignment:
266 aaatggaggaccaaaagtggaagaatctgaaattacagggac 307  Q
    ||||| ||||||||||||||| |||||||||||||| |||||    
31090216 aaatgaaggaccaaaagtggaggaatctgaaattacggggac 31090257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 7 - 99
Target Start/End: Original strand, 12520636 - 12520731
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgt--aaaaaataagatttagattttgt-cctataatttca 99  Q
    |||||| ||||| ||||| |||||| ||| |||||||||||||  |||||||| || |  |||||| ||  |||||||||||| ||||||||||||    
12520636 agggttcataccacttttagtccctataatattagcgaattccagttttagtccctattaaaaaaaaaaagtttagattttgtccctataatttca 12520731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 373
Target Start/End: Original strand, 26252559 - 26252601
Alignment:
330 acaggaagctaaaactggaattccctaatattacanggacgaaa 373  Q
    ||||||| ||||||||||||||| ||||||||||| ||||||||    
26252559 acaggaa-ctaaaactggaattcgctaatattacagggacgaaa 26252601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 6 - 70
Target Start/End: Original strand, 46934069 - 46934133
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaa 70  Q
    ||||||||||| | ||||| |||||||||| |||| | ||||||| ||||||||  |||||||||    
46934069 tagggttaatatcacttttggtccctgtaatattaacaaattccggttttagtccgtgtaaaaaa 46934133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 63)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 7126297 - 7125990
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| ||||||||||||  ||||||||| |||||||||||||| ||||||||| ||||||||| |||||||||||||||||| | ||||||||||| |    
7126297 tagggtaaatacctcttttcatccctgtaatattagcgaattccggttttagtctttgtaaaaaaaaagatttagattttgtccctgtaatttcatattc 7126198  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||     
7126197 ttccacttttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcatattcctcccacttttggtccctgtaatttcaa 7126098  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | |||   |||||||||||||||||||||||||||| |||    
7126097 attcctccacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtggtggaataagggaccaaaagtggaagaatctgaaattatagg 7125998  T
305 gacaaaat 312  Q
    ||||||||    
7125997 gacaaaat 7125990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 5 - 308
Target Start/End: Complemental strand, 6817502 - 6817199
Alignment:
5 gtagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatg 103  Q
    |||||||||||| |||||||  | || |||| |||||||||||   |||||||||||||||||||| || ||||||||||||||| | |||||||||||     
6817502 gtagggttaatatctcttttcattcccgtaatattagcgaattttaattttagtctctgtaaaaaaaaaaatttagattttgtccctgtaatttcatatt 6817403  T
104 cttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttca 203  Q
    |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  |||||||||||    
6817402 cttccacttttggtcactcctttcatcacatcagcagaatatgcataaattacgtccctgtaatttcaaattcctcccacttttgat-tctgtaatttca 6817304  T
204 gattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacag 303  Q
    ||||||||||||||| |||||| |||||||||| |||| ||||||||| |||| |||||| ||||||  ||||||||||||||||||||||||||||||     
6817303 gattcctccatttttggtcccttattttacgtgccatgtatgcagattctgctgacgtggtgaaatgagggaccaaaagtggaagaatctgaaattacat 6817204  T
304 ggaca 308  Q
    |||||    
6817203 ggaca 6817199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 7 - 308
Target Start/End: Complemental strand, 20709590 - 20709289
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    |||||||||||||||||| |||| ||||| |||| ||||||  | |||||||| |||||||||| |||||||||||||||||| | ||||||||||| ||    
20709590 agggttaatacctcttttcgtccatgtaatattaacgaattttggttttagtccctgtaaaaaa-aagatttagattttgtccatgtaatttcatattct 20709492  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| |||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| |    
20709491 tccactttttgtccttcctttcatcacatcagcagaatatgcataaattacatccctgtaatttcagattcctcccacttttgatccctgtaatttcata 20709392  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| ||||||  ||||||||||||||||||| |||||||||||||    
20709391 ttcctccactttttgtccctcattttacgtgccatgtatgcagattctgctgacgtggtgaaatgagggaccaaaagtggaagaatttgaaattacaggg 20709292  T
306 aca 308  Q
    |||    
20709291 aca 20709289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 7 - 312
Target Start/End: Original strand, 14143901 - 14144206
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||| | ||||||||||| ||    
14143901 agggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaaaaa-aagatttagattttgtccctgtaatttcatattct 14143999  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| ||||||| |||| ||||||||| |||| ||||| ||||||||||||||||||||||||| | |||||| ||||||||| ||| |||||||||| |    
14144000 tccacttttggtacctcatttcatcacgtcagtagaatctgcataaattacgtccctgtaatttcagattccttccacttttggtccatgtaatttcaaa 14144099  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| || | |||||| | |||   ||||||||||||||||||| |||||||||||||    
14144100 ttcctccacttttggtccctcattttacgtgccatgtatgcagattctggtgacgtggtggaataagggaccaaaagtggaagaatttgaaattacaggg 14144199  T
306 acaaaat 312  Q
    |||||||    
14144200 acaaaat 14144206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 41001725 - 41001426
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    ||||||| |||| |||||||||| |||||||||||||| ||||||||  ||||||||| |||||||||||||||||| |||||||||| || |||||| |    
41001725 aataccttttttcgtccctgtaatattagcgaattccggttttagtccttgtaaaaaa-aagatttagattttgtccctataatttcagattcttccact 41001627  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||  ||| |||||  | ||||||||| ||| ||||||||| |  |||||||||||| || ||||||||||||||||||||||    
41001626 tttggtccctcctttcatcaagtcaacagaacctacataaattatgtcactgtaatttcatcttcctcccacttctggtccctgtaatttcagattcctc 41001527  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    ||||||||||||||||||||||||| |||| ||||||||| |||| || ||| | |||| |||||||||||||||||||| |||||||||||||||||||    
41001526 catttttagtccctcattttacgtgccatgtatgcagattctgcttacatggtggaatgaaggaccaaaagtggaagaatatgaaattacagggacaaaa 41001427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 7 - 312
Target Start/End: Original strand, 17762282 - 17762587
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||| |||||||| ||||||| ||| |||||||| || ||    
17762282 agggtaaatacctctttttgtccctgtaatattagcgaattccggttttagtccctgtaaaaaa-aagatttatattttgttcctgtaatttcagattct 17762380  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| |||||||||||||||| ||||| | |||||||| ||||||||||||||||||||||||| | ||||||||| |||||| |||||||||||| |||    
17762381 tccacttttggtccctcctttaatcacgtaagcagaatctgcataaattacgtccctgtaatttcatattcctcccgcttttggtccctgtaattttaga 17762480  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||| ||  |||| ||||| ||| |||| |||||| | ||||  ||||||||||||||||||||||||||||  |||    
17762481 ttcctccacttttggtccctcattttatgtcccatgtatgcaaattctgcttacgtggtggaatgagggaccaaaagtggaagaatctgaaattatgggg 17762580  T
306 acaaaat 312  Q
    |||||||    
17762581 acaaaat 17762587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 29444811 - 29445111
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtccta-taatttcatatgcttccatt 111  Q
    |||| ||||||| |||||||||| |||| ||||||| |||||||||| |||||||||| | |||||||||| ||||||  ||||||||||| |||| | |    
29444811 aatatctcttttcgtccctgtaatattaacgaattctgattttagtccctgtaaaaaaaaggatttagattatgtccttgtaatttcatattcttctact 29444910  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||| | ||||| |||||||||||||| ||||||     
29444911 tttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctcctagttttggtccctgtaatttcaaattccta 29445010  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    ||||||| ||||||||||||||||| |||| ||||| ||||| || |||||| | |||   |||||||||||||||||||||||||||||| ||||||||    
29445011 cattttttgtccctcattttacgtgtcatgtatgcaaattttactgacgtggtggaataagggaccaaaagtggaagaatctgaaattacaaggacaaaa 29445110  T
312 t 312  Q
    |    
29445111 t 29445111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 31800012 - 31799713
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||||||||||| |||||| ||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||| | |||||||| || |||||  |    
31800012 aatacctcttttcgtccctataatattagcgaattccggttttagtc-ctgtaaaaaaaaagatttagattttgtccatgtaatttcagattcttcctct 31799914  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    |||| |||||||||||||||| |||||||||| |||||||||||||||||| |||||| | |||||||||||||||| |||||||||||||| | |||||    
31799913 tttgatccctcctttcatcacgtcagcagaatttgcataaattacgtccctttaatttcagattcctcccacttttggtccctgtaatttcaaaatcctc 31799814  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| |||||||||||||| || |||| || || ||| |||| |||||| | |||   |||||||||||||||||||||||||||||||||||||||    
31799813 cacttttggtccctcattttacatgccatgtatacaaattctgcttacgtggtggaataagggaccaaaagtggaagaatctgaaattacagggacaaaa 31799714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 6 - 312
Target Start/End: Original strand, 24074301 - 24074607
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgc 104  Q
    |||||| |||||||||||| |||| ||||| ||||||||||| || |||||||| |||||||||| || |||||||||||||| || ||||||||||| |    
24074301 tagggtaaatacctcttttcgtccatgtaatattagcgaatttcggttttagtccctgtaaaaaaaaatatttagattttgtctctgtaatttcatattc 24074400  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||  |||||| | |||| ||||||||||||| ||||||||||||     
24074401 ttccacttttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccccataatttcagattcatcccacttttgat-cctgtaatttcaa 24074499  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||| ||||| |||| ||||||||||||||||| |||  ||||||||| |||| ||||||  ||||   ||||||||||||||||||| |||||||||| |    
24074500 atttctccacttttggtccctcattttacgtgccatatatgcagattctgctgacgtggttaaataagggaccaaaagtggaagaatatgaaattacaag 24074599  T
305 gacaaaat 312  Q
    ||||||||    
24074600 gacaaaat 24074607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 8 - 312
Target Start/End: Complemental strand, 24837547 - 24837242
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||||||||||| |||||||||| |||||||||||||  |||||||| |||||||||| |||||||||||||||||| | |||||||| || |||    
24837547 gggtaaatacctcttttcgtccctgtaatattagcgaattccagttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcaaattctt 24837448  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    | | ||||| |||||||||||||||  ||| |||||| |||||||||||||||| |||||||| | ||||||| |||||||| |||||||||||||||||    
24837447 ctacttttgctccctcctttcatcaagtcaacagaatctgcataaattacgtccttgtaatttcagattcctctcacttttggtccctgtaatttcagat 24837348  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| ||||  |||||||||||||||  |||| || |||||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||| |||    
24837347 tcctccacttttgatccctcattttacgtaccatgtatacagattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattacaagga 24837248  T
307 caaaat 312  Q
    ||||||    
24837247 caaaat 24837242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 24651079 - 24650773
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||||||||||| ||| |||||| |||||||||||||| ||||||||  ||||||||| || || |||||||| ||| | |||||| | || |    
24651079 tagggtaaatacctcttttcgtctctgtaatattagcgaattccggttttagtccatgtaaaaaagaaaatctagattttatccctgtaattttagattc 24650980  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| ||||| |||||||||||||||| ||||||||||  ||||||||||| |||||||||||| | ||| |||||||||| | |||||||||||||||    
24650979 ttccacttttgatccctcctttcatcacgtcagcagaatccgcataaattacatccctgtaatttcatatttctcccactttgg-tccctgtaatttcag 24650881  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    |||||||||||||| ||||||||||||||||| |||| |||||||||||||| |||||| | ||||    ||||||||||||||||| ||||||||||||    
24650880 attcctccatttttggtccctcattttacgtgccatgtatgcagattttgctgacgtggtggaatgagctaccaaaagtggaagaatatgaaattacagg 24650781  T
305 gacaaaat 312  Q
     |||||||    
24650780 aacaaaat 24650773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 4919362 - 4919063
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||||||||||| ||| ||| || |||||||||||||| |||||||  |||||||||| || ||| ||||||||||| | |||||||| || |||| | |    
4919362 aatacctcttttcgtctctggaatattagcgaattccggttttagttcctgtaaaaaaaaaaatt-agattttgtccctgtaatttcagattcttctact 4919264  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    |||| |||||||||||||||  ||| ||||||||||||||||||||||| |||||||| | |||||||| ||||||| || ||||||||||| |||||||    
4919263 tttgatccctcctttcatcaagtcaacagaatatgcataaattacgtccttgtaatttcatattcctccaacttttggtcactgtaatttcaaattcctc 4919164  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||  |||| ||||| ||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||||||||||||    
4919163 cacttttggtccctcattttacgtaccatgtatgcaaattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattacagggacaaaa 4919064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 8 - 312
Target Start/End: Complemental strand, 994123 - 993820
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| ||||||| |||||||||| |||| | ||||||||| || |||||||| ||||| || | |||||||||||||||||| | ||||| || || |||    
994123 gggtaaatacct-tttttgtccccgtaataatagcgaatttcggttttagtccctgtagaataaaagatttagattttgtccctgtaattgcagattctt 994025  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    ||| |||||||||||||||| ||||  ||| |||||| || |||||||||||||||||||||| | |||||||||||||||| ||||||||||| || ||    
994024 ccacttttggtccctccttttatcatgtcaacagaatctgtataaattacgtccctgtaatttcagattcctcccacttttggtccctgtaatt-catat 993926  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||| |||||||||| |||    
993925 tcctccacttttggtccctcattttacgtgtcatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattacaagga 993826  T
307 caaaat 312  Q
    | ||||    
993825 ctaaat 993820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 18336467 - 18336761
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataa-gatttagattttgtcc-tataatttcatatgct 105  Q
    |||| |||| ||||||| |||||| ||| ||||||||||||||||||||||| |||||||||| || |||||||||||||||| | |||||||| || ||    
18336467 gggtaaatatctcttttcgtccctataatattagcgaattccgattttagtccctgtaaaaaaaaaagatttagattttgtccctgtaatttcagattct 18336566  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||  ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||             ||||||||||||||||    
18336567 tccgcttttgatccctcctttcatcacatcagcagaatttgcataaattacgtccctgtaatttcagattc------------gtccctgtaatttcaga 18336654  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| || || ||| |||| || ||| | |||   ||| |||||||||||||||||||||||||||||    
18336655 ttcctccacttttggtccctcattttacgtgacatgtatacaaattctgcttacatggtgtaataagggatcaaaagtggaagaatctgaaattacaggg 18336754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 6 - 194
Target Start/End: Original strand, 14411695 - 14411884
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||||||||||| |||||||||| |||||||||||||| |||||||| ||||| |||| |||||||| ||||||||  | |||||||| || |    
14411695 tagggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtataaaaaaagatttatattttgtctatgtaatttcagattc 14411794  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccct 194  Q
    ||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||||||||||| |||||    
14411795 ttccacttttggtccctcctttcatcacgtcagcagaatttgcataaattacgtccctgtaatttcagattcctcccacttttggtccct 14411884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 27159328 - 27159148
Alignment:
12 taatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccat 110  Q
    ||||||||||||| |||| ||||| ||||||||||| || ||||||||  ||||||||| |   |||||||||||||| | |||||| |||| |||||||    
27159328 taatacctcttttcgtccttgtaatattagcgaatttcggttttagtccttgtaaaaaaaa---tttagattttgtccctgtaattttatattcttccat 27159232  T
111 ttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccct 194  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||    
27159231 ttttggtcccttctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctcccacttttgatccct 27159148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 147 - 312
Target Start/End: Original strand, 23979042 - 23979206
Alignment:
147 cataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatttttagtccctcattttacgtgncatgnatgc 246  Q
    |||||||||||||| |||||||| | ||| |||||||||||| ||||| |||||||||||| |||||  ||| |||| |||||||||||| |||| ||||    
23979042 cataaattacgtccttgtaatttcatatttctcccacttttggtccctttaatttcagattactccacgtttggtcc-tcattttacgtgtcatgtatgc 23979140  T
247 agattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||| |||| |||||| ||||||  ||||||||||||||||||| ||||||||||||||||||||    
23979141 agattctgctgacgtggtgaaatgagggaccaaaagtggaagaatttgaaattacagggacaaaat 23979206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 8 - 150
Target Start/End: Complemental strand, 23979279 - 23979136
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgctt 106  Q
    |||| |||||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||| ||| |||||||| || |||    
23979279 gggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcaaattctt 23979180  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||| |||||||||||| ||||| ||| |||||||||| ||||||    
23979179 ccacttttggtccctcatttcaccacgtcagcagaatctgcata 23979136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 11 - 150
Target Start/End: Original strand, 7125921 - 7126060
Alignment:
11 ttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttcca 109  Q
    |||||||||||||| || ||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||| || ||||||    
7125921 ttaatacctcttttcgttcctgtaatattagcgaattccgattttagtccctgtaaaaaa-aagatttagattttgtccctataatttcagattcttcca 7126019  T
110 tttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
     |||||||||||  || || ||| |||||||||| ||||||    
7126020 cttttggtcccttattccaccacgtcagcagaatctgcata 7126060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 6 - 143
Target Start/End: Original strand, 24837167 - 24837305
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||||||||||| |||||||||| | |||||||||||| |||||||| |||||||||| |||||||||||||||||| | ||||||||||| |    
24837167 tagggtaaatacctcttttcgtccctgtaataatagcgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccttgtaatttcatattc 24837266  T
105 ttccatttttggtccctcctttcatcacatcagcagaat 143  Q
    ||||| |||||||||||| || || ||| | ||||||||    
24837267 ttccacttttggtccctcattccaccacgtaagcagaat 24837305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 6 - 150
Target Start/End: Complemental strand, 14144281 - 14144136
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgc 104  Q
    ||||||||||||||||||| ||| |||||| |||| |||||||||||||||||| |||||||||| |||||||||||||||| ||| |||||||| || |    
14144281 tagggttaatacctcttttcgtcactgtaatattaacgaattccgattttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcaaattc 14144182  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||| |||||||||||  || || ||| ||| |||||| ||||||    
14144181 ttccacttttggtcccttattccaccacgtcaccagaatctgcata 14144136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 190 - 312
Target Start/End: Original strand, 14411848 - 14411971
Alignment:
190 tccctgtaatttcagattcctcc-atttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaag 288  Q
    ||||||||||||||||||||||| | |||| ||||||||||||||||| |||| ||| ||||| |||| |||||| | ||||  |||||||| |||||||    
14411848 tccctgtaatttcagattcctcccacttttggtccctcattttacgtgtcatgtatgtagattctgcttacgtggtggaatgagggaccaaacgtggaag 14411947  T
289 aatctgaaattacagggacaaaat 312  Q
    |||||||||||||| |||||||||    
14411948 aatctgaaattacaaggacaaaat 14411971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 6 - 150
Target Start/End: Complemental strand, 17762662 - 17762517
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgc 104  Q
    |||||| |||||||||||| |||||||||  |||||||||||| | |||||||| |||||||||| |||||||||||||||| || ||||||||| || |    
17762662 tagggtaaatacctcttttcgtccctgtagtattagcgaattctggttttagtccctgtaaaaaaaaagatttagattttgtccccataatttcagattc 17762563  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||| |||||||||||| || || ||| | |||||||| ||||||    
17762562 ttccacttttggtccctcattccaccacgtaagcagaatttgcata 17762517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 6817122 - 6817265
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||| ||||| ||||| |||||||| |||||||| |||||||||| |||||||||||| ||||| | |||||||| || ||    
6817122 agggtaaatacctcttttcgtccttgtaatattagtgaattccggttttagtccctgtaaaaaa-aagatttagattatgtccatgtaatttcagattct 6817220  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| ||||| ||| |||||||||| ||||||    
6817221 tccacttttggtccctcatttcaccacgtcagcagaatctgcata 6817265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 31 - 303
Target Start/End: Complemental strand, 22571432 - 22571159
Alignment:
31 tgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatttttggtccctcctttcat 129  Q
    ||||| ||||||||||| || ||||||||| | || |||| || | ||||||||||| | | |||||||| || ||||   ||||| |||||| |||||     
22571432 tgtaatattagcgaatttcggttttagtctttatataaaaaaaaaattagattttgttcatgtaatttcaaattcttctcgttttgctccctcatttcac 22571333  T
130 cacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctccatttttagtccctcatt 229  Q
    ||| ||| || ||| ||||||||||||||||||||||||| |  ||||||| || |||| ||||| |||||||| |||| |||  |||| ||||||||||    
22571332 cacgtcaacaaaatctgcataaattacgtccctgtaatttcaggttcctcctacatttggtccctctaatttcatattcatccgcttttggtccctcatt 22571233  T
230 ttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacag 303  Q
    | ||||  || | |  || ||| |  | |||||| ||||||  ||||||||||||||||||| |||||||||||    
22571232 tcacgtatcacgcacacatattcttttgacgtggtgaaatgagggaccaaaagtggaagaatatgaaattacag 22571159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 190 - 316
Target Start/End: Complemental strand, 27159184 - 27159059
Alignment:
190 tccctgtaatttcagattcctcc-atttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaag 288  Q
    ||||||||||||||||||||||| | ||||  |||||||||||||||| |  | ||| |||||||||| |||||| | |||   ||||||||||||||||    
27159184 tccctgtaatttcagattcctcccacttttgatccctcattttacgtgcc--gtatgtagattttgctgacgtggtggaataagggaccaaaagtggaag 27159087  T
289 aatctgaaattacagggacaaaatttaa 316  Q
    ||||||||||||||||||||||||||||    
27159086 aatctgaaattacagggacaaaatttaa 27159059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 7 - 146
Target Start/End: Original strand, 22571076 - 22571216
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgct 105  Q
    |||||||||||   ||||||||| ||||| ||||||||||||||||||||||| |||||||||| || ||||||||| | || || ||||||||||| ||    
22571076 agggttaatactgatttttgtccttgtaatattagcgaattccgattttagtccctgtaaaaaaaaaaatttagattatatctctgtaatttcatattct 22571175  T
106 tccatttttggtccctcctttcatcacatcagcagaatatg 146  Q
    |||| |||||||||||| ||||| ||| |||  ||||||||    
22571176 tccacttttggtccctcatttcaccacgtcaaaagaatatg 22571216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 29445184 - 29445070
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    |||||||||| ||||||| |||||||||| |||||||||||||  |||||||| |||||||||| |||||||||||||||||| | |||||||| || ||    
29445184 agggttaatatctcttttcgtccctgtaatattagcgaattccagttttagtc-ctgtaaaaaaaaagatttagattttgtccttgtaatttcagattct 29445086  T
106 tccatttttggtccct 121  Q
    |||| |||||||||||    
29445085 tccacttttggtccct 29445070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 18336833 - 18336720
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgctt 106  Q
    |||| |||||||||||| ||||||||||| ||||||||||||| |||||||| |||||||||| |||||||||||||||| ||| |||||||| || |||    
18336833 gggtaaatacctcttttcgtccctgtaaa-ttagcgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcagattctt 18336735  T
107 ccatttttggtccct 121  Q
    ||| ||||| |||||    
18336734 ccacttttgatccct 18336720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 31799640 - 31799754
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgctt 106  Q
    |||| |||||||||||| |||||| ||| |||||||||||||| ||| |||| |||||||||| |||||||||||||||| ||| |||||||| || |||    
31799640 gggtaaatacctcttttcgtccctataatattagcgaattccggtttcagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcagattctt 31799739  T
107 ccatttttggtccct 121  Q
    ||| |||||||||||    
31799740 ccacttttggtccct 31799754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 6 - 150
Target Start/End: Original strand, 4918987 - 4919133
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgt-aaaaaataagatttagattttgt-cctataatttcatatg 103  Q
    |||||| ||||||||||||  || |||||| ||||||||||| || |||||||  |||| |||||| |||||||||||||||| ||| |||||||||||     
4918987 tagggtaaatacctcttttcatctctgtaatattagcgaatttcggttttagttcctgtaaaaaaaaaagatttagattttgtccctgtaatttcatatt 4919086  T
104 cttccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||||| |||||||||||| || || ||| | |||||||| ||||||    
4919087 cttccacttttggtccctcattccaccacgtaagcagaatttgcata 4919133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 24074649 - 24074537
Alignment:
39 tagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatttttggtccctcctttcatcacatcag 137  Q
    |||||||||||| ||||| || |||||||||| |||||||||||||||||| | ||||||||||| |||||| |||||||||||  ||| | ||| ||||    
24074649 tagcgaattccggttttaatccctgtaaaaaaaaagatttagattttgtccttgtaatttcatattcttccacttttggtcccttatttaaccacgtcag 24074550  T
138 cagaatatgcata 150  Q
    |||||| ||||||    
24074549 cagaatctgcata 24074537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 215 - 312
Target Start/End: Complemental strand, 30512458 - 30512360
Alignment:
215 ttttagtccctcatttt-acgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||| |||||||||||| ||||| |||| ||||||||| |||| |||||| | ||||  ||||||||||||||| ||||||||||||||||||| ||||    
30512458 ttttcgtccctcatttttacgtgccatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaaaaatctgaaattacagggaccaaat 30512360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 215 - 312
Target Start/End: Complemental strand, 30552798 - 30552700
Alignment:
215 ttttagtccctcatttt-acgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||| |||||||||||| ||||| |||| ||||||||| |||| |||||| | ||||  ||||||||||||||| ||||||||||||||||||| ||||    
30552798 ttttcgtccctcatttttacgtgccatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaaaaatctgaaattacagggaccaaat 30552700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 13 - 150
Target Start/End: Original strand, 993755 - 993890
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    ||||| |||||| ||| |||||| |||||||||||||| |||||||| |||||||||| ||   |||||||| |||| | ||||||||||| |||||| |    
993755 aatacttcttttcgtctctgtaatattagcgaattccggttttagtccctgtaaaaaaaaa---ttagatttagtccttgtaatttcatattcttccact 993851  T
112 tttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||||||||| || || ||| | |||||||| ||||||    
993852 tttggtccctcattccaccacgtaagcagaatctgcata 993890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 13 - 150
Target Start/End: Original strand, 24650707 - 24650843
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttg-tcctataatttcatatgcttccatt 111  Q
    |||||||||||| |||||||||| |||| |||||| || ||||| ||| ||||||||  ||||||||||||||| |||| ||||||||||| |||||| |    
24650707 aatacctcttttcgtccctgtaatattaacgaatttcggttttaatctatgtaaaaa--aagatttagattttgttcctgtaatttcatattcttccact 24650804  T
112 tttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||||||  ||| || || ||| |||||| ||| ||||||    
24650805 tttggtagctcattccaccacgtcagcaaaatctgcata 24650843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 27158990 - 27159104
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    |||||||||||||||||| |||| ||||| ||||||||||| |  |||||||||| || ||||| |||||||| ||||||| ||| |||||||| || ||    
27158990 agggttaatacctcttttcgtccatgtaatattagcgaatttcagttttagtctcagttaaaaa-aagatttaaattttgtccctgtaatttcagattct 27159088  T
106 tccatttttggtccct 121  Q
    |||| |||||||||||    
27159089 tccacttttggtccct 27159104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 37 - 150
Target Start/End: Original strand, 20709239 - 20709355
Alignment:
37 attagcgaattccgattttagtctctgt--aaaaaataagatttagattttgtcc-tataatttcatatgcttccatttttggtccctcctttcatcaca 133  Q
    ||||| |||||||| ||||||||  |||  |||||| |||||||||||| ||||| | |||||||| || |||||| |||||||||||| ||||| |||     
20709239 attagtgaattccggttttagtccatgtgaaaaaaaaaagatttagattctgtccctgtaatttcaaattcttccacttttggtccctcatttcaccacg 20709338  T
134 tcagcagaatatgcata 150  Q
    |||||||||| ||||||    
20709339 tcagcagaatctgcata 20709355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 30512287 - 30512430
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||| ||||||| |||||||||| ||||| |||||  | |||||||| |||||||||| | ||||||||||| |||| | |||||||| ||  |    
30512287 agggtaaatatctcttttcgtccctgtaatattagtgaattttggttttagtccctgtaaaaaa-aggatttagatttggtccctgtaatttcagatttt 30512385  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| || || ||| | |||||||| ||||||    
30512386 tccacttttggtccctcattccaccacgtaagcagaatctgcata 30512430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 30552627 - 30552770
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||| ||||||| |||||||||| ||||| |||||  | |||||||| |||||||||| | ||||||||||| |||| | |||||||| ||  |    
30552627 agggtaaatatctcttttcgtccctgtaatattagtgaattttggttttagtccctgtaaaaaa-aggatttagatttggtccctgtaatttcagatttt 30552725  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| || || ||| | |||||||| ||||||    
30552726 tccacttttggtccctcattccaccacgtaagcagaatctgcata 30552770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 26 - 119
Target Start/End: Original strand, 41001374 - 41001465
Alignment:
26 gtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttccatttttggtcc 119  Q
    |||||||||| ||||||||||| || |||||||| |||||||||| ||   ||||||||||| ||| ||||||||||| |||||| |||||||||    
41001374 gtccctgtaatattagcgaatttcggttttagtccctgtaaaaaaaaa---ttagattttgtccctgtaatttcatattcttccacttttggtcc 41001465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 243 - 312
Target Start/End: Original strand, 7126153 - 7126222
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| |||| |||||  |||| |  ||||||||||||||||||| ||||||||||||||||||||    
7126153 atgcagattctgctgacgtgatgaaaggagggaccaaaagtggaagaatatgaaattacagggacaaaat 7126222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 6 - 143
Target Start/End: Complemental strand, 14412045 - 14411908
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| ||||||||||||  || || ||| |||| |||||| || |||||||| |||||||||| || ||||||||||||||| | |||||||| || |    
14412045 tagggtaaatacctcttttcatctctataatattaacgaatttcggttttagtccctgtaaaaaa-aaaatttagattttgtccttgtaatttcagattc 14411947  T
105 ttccatttttggtccctcctttcatcacatcagcagaat 143  Q
    |||||  ||||||||||| || || ||| | ||||||||    
14411946 ttccacgtttggtccctcattccaccacgtaagcagaat 14411908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 20947016 - 20947053
Alignment:
193 ctgtaatttcagattcctccatttttagtccctcattt 230  Q
    ||||||||||||||||||||||||||||||||||||||    
20947016 ctgtaatttcagattcctccatttttagtccctcattt 20947053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 994012 - 994051
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||||||| |||||||||||||||||    
994012 ggaccaaaagtggaagaatctgcaattacagggacaaaat 994051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 17762394 - 17762355
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||||||||||||||||| |||||||    
17762394 ggaccaaaagtggaagaatctgaaattacaggaacaaaat 17762355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 246 - 312
Target Start/End: Original strand, 20959330 - 20959396
Alignment:
246 cagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||| ||||||| |||  ||||| | ||||||||||||| |||||||||||| ||||||||||||    
20959330 cagattctgctaacatggttaaatgaacgaccaaaagtggaggaatctgaaattgcagggacaaaat 20959396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 41001619 - 41001658
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||||||||||||| |||||||||||    
41001619 ggaccaaaagtggaagaatctgaaattatagggacaaaat 41001658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 274 - 312
Target Start/End: Original strand, 6817388 - 6817426
Alignment:
274 gaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||||||||||||||| ||||||||||||||||||||    
6817388 gaccaaaagtggaagaatatgaaattacagggacaaaat 6817426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 14144043 - 14143974
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| | || |||||  ||||||  | ||||||||||||||||| ||||||||||||||||||||    
14144043 atgcagattctactgacgtgatgaaatgaggtaccaaaagtggaagaatatgaaattacagggacaaaat 14143974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 24074445 - 24074376
Alignment:
243 atgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||| |||| |||||  |||| |  ||||||||||||||||||| ||||||||||| ||||||||    
24074445 atgcagattctgctgacgtgatgaaaggagggaccaaaagtggaagaatatgaaattacagagacaaaat 24074376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 6 - 122
Target Start/End: Original strand, 41424514 - 41424631
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgc 104  Q
    ||||||||||||||||||| |||| || || |||||||||||||| |||  |||  ||||||||| ||  |||||||| ||| ||| | |||||| || |    
41424514 tagggttaatacctcttttggtccttgcaatattagcgaattccggtttaggtccttgtaaaaaaaaaagtttagattctgtccctgtcatttcagattc 41424613  T
105 ttccatttttggtccctc 122  Q
    ||||| |||| |||||||    
41424614 ttccacttttagtccctc 41424631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 6 - 70
Target Start/End: Complemental strand, 41425832 - 41425768
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaa 70  Q
    ||||||||||||||||||| ||||||| || || ||||||||| |||||| |||  |||||||||    
41425832 tagggttaatacctcttttggtccctgcaatatcagcgaattctgattttggtccttgtaaaaaa 41425768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 312
Target Start/End: Original strand, 4919260 - 4919295
Alignment:
277 caaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||| ||||||||||||||||||||||||||||    
4919260 caaaagtagaagaatctgaaattacagggacaaaat 4919295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 14411809 - 14411770
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||||||||||||||||||||||||||||  ||||||||    
14411809 ggaccaaaagtggaagaatctgaaattacatagacaaaat 14411770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 312
Target Start/End: Complemental strand, 18336576 - 18336541
Alignment:
277 caaaagtggaagaatctgaaattacagggacaaaat 312  Q
    |||||| |||||||||||||||||||||||||||||    
18336576 caaaagcggaagaatctgaaattacagggacaaaat 18336541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 28071877 - 28071814
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaa 70  Q
    |||||||||||| ||||| |||||||||| || |||||||| || ||||||||  |||||||||    
28071877 agggttaataccccttttggtccctgtaatatgagcgaatttcggttttagtcattgtaaaaaa 28071814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 273 - 307
Target Start/End: Complemental strand, 18336672 - 18336638
Alignment:
273 ggaccaaaagtggaagaatctgaaattacagggac 307  Q
    |||||||||||||| ||||||||||||||||||||    
18336672 ggaccaaaagtggaggaatctgaaattacagggac 18336638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 189 - 230
Target Start/End: Complemental strand, 41425751 - 41425710
Alignment:
189 atccctgtaatttcagattcctccatttttagtccctcattt 230  Q
    |||||||| ||||||||||| ||||| |||||||||||||||    
41425751 atccctgtcatttcagattcttccatctttagtccctcattt 41425710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 312
Target Start/End: Original strand, 20709477 - 20709517
Alignment:
272 aggaccaaaagtggaagaatctgaaattacagggacaaaat 312  Q
    ||||| |||||||||||||| |||||||||| |||||||||    
20709477 aggacaaaaagtggaagaatatgaaattacatggacaaaat 20709517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 373
Target Start/End: Original strand, 24837498 - 24837533
Alignment:
338 ctaaaactggaattccctaatattacanggacgaaa 373  Q
    ||||||||||||||| ||||||||||| ||||||||    
24837498 ctaaaactggaattcgctaatattacagggacgaaa 24837533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 373
Target Start/End: Original strand, 29445134 - 29445169
Alignment:
338 ctaaaactggaattccctaatattacanggacgaaa 373  Q
    ||||||||||||||| ||||||||||| ||||||||    
29445134 ctaaaactggaattcgctaatattacagggacgaaa 29445169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 190 - 230
Target Start/End: Original strand, 41424595 - 41424635
Alignment:
190 tccctgtaatttcagattcctccatttttagtccctcattt 230  Q
    ||||||| ||||||||||| |||| ||||||||||||||||    
41424595 tccctgtcatttcagattcttccacttttagtccctcattt 41424635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 86)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 14262415 - 14262109
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||| | |||||||||||  |    
14262415 agggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcatattgt 14262316  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| |||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |    
14262315 tccacttttagtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaattttagattccttccacttttgatccctgtaatttcaaa 14262216  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| | |||| | |||   |||||||||||||||||||||||||||||||||    
14262215 ttcctccacttttggtccctcattttacgtgccatgtatgcagattctgctgatgtggtggaataagggaccaaaagtggaagaatctgaaattacaggg 14262116  T
306 acaaaat 312  Q
    |||||||    
14262115 acaaaat 14262109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 7 - 316
Target Start/End: Original strand, 45969914 - 45970224
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| ||||| |||||||| |||||||| |||||||||| |||||||||||||||||| | |||||||| || ||    
45969914 agggtaaatacctcttttcgtccctgtaatattagtgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcagattct 45970013  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    | || |||||||| ||||||||||||  ||| |||||| ||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||    
45970014 ttcacttttggtctctcctttcatcaagtcaacagaatctgcataaattacgtccctgtaatttcagattcctcccacttttggtccctgtaatttcaga 45970113  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    || ||||| |||| ||||||||||||||||| |||| |||| |||| |||| |||||| | ||||| | |||||||||||||||||||||||||||||||    
45970114 tttctccacttttggtccctcattttacgtgtcatgtatgcggattctgcttacgtggtggaatggggaaccaaaagtggaagaatctgaaattacaggg 45970213  T
306 acaaaatttaa 316  Q
    |||||||||||    
45970214 acaaaatttaa 45970224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 14161871 - 14162176
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||| ||||||| |||||||||| |||||||||||||  |||||||  || ||||||| |||||||||||| ||||| | ||||||||||| |||    
14161871 gggtaaatatctcttttcgtccctgtaatattagcgaattccagttttagttcctataaaaaaaaagatttagattatgtccctgtaatttcatattctt 14161970  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    ||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||| | ||||| |||||||||||||| ||    
14161971 ccacttttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctcctaattttggtccctgtaatttcaaat 14162070  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    |||||||||||| ||||||||||||||||| |||| ||||| |||||||| |||||| | |||   |||||||||||||||||||||||||||||| |||    
14162071 tcctccatttttggtccctcattttacgtgccatgtatgcaaattttgctgacgtggtggaataagggaccaaaagtggaagaatctgaaattacaagga 14162170  T
307 caaaat 312  Q
    ||||||    
14162171 caaaat 14162176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 14171966 - 14171659
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||||||||||| |||||||||| |||||||||||||| |||||||| ||||||| || |||||||||||||||||| | |||||||  || |    
14171966 tagggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaataaaaagatttagattttgtccctgtaatttctgattc 14171867  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| ||||||||| |||||||||||| |||||| ||| ||||| ||||||| || |||||||| | |||||||||||||||| |||||||||||||||    
14171866 ttccacttttggtccttcctttcatcacgtcagcaaaatctgcatcaattacgaccttgtaatttcagattcctcccacttttggtccctgtaatttcag 14171767  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||||||||||||||  |||||||||||||||| |||| ||||||||| |||| |||||| | ||||  ||| ||||||||||||||| ||||||||||||    
14171766 attcctccatttttgatccctcattttacgtgccatgtatgcagattctgctgacgtggtggaatgagggatcaaaagtggaagaatttgaaattacagg 14171667  T
305 gacaaaat 312  Q
    ||||||||    
14171666 gacaaaat 14171659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 5800605 - 5800910
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||||||||||| |||||||||| |||| |||||| || |||||||| |||||||||| | |||||||||| ||||| | ||||||||||| |||    
5800605 gggtaaatacctcttttcgtccctgtaatattaacgaatttcggttttagtccctgtaaaaaaaaggatttagattatgtccctgtaatttcatattctt 5800704  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||| | ||||| |||||||||||||| ||    
5800705 ccatttttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctcctagttttggtccctgtaatttcaaat 5800804  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    |||||||||||| |||||||||||||| || |||| ||||| |||||||| | |||| | |||   ||||||||||||||||||| |||||||||| |||    
5800805 tcctccatttttggtccctcattttacatgccatgtatgcaaattttgctgaagtggtggaataagggaccaaaagtggaagaatatgaaattacaagga 5800904  T
307 caaaat 312  Q
    ||||||    
5800905 caaaat 5800910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 7 - 312
Target Start/End: Original strand, 16721990 - 16722296
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| || ||||||||||||||| | |||||||| || ||    
16721990 agggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtcactgtaaaaaaaaaaatttagattttgtccatgtaatttcagattct 16722089  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| ||||||||||| |||||||||  ||| |||||| ||||||||||| ||| ||||||||| | ||||||||||||| || ||||||||||||||||    
16722090 tccacttttggtcccttctttcatcaagtcaacagaatctgcataaattatgtcactgtaatttcagattcctcccacttctggtccctgtaatttcaga 16722189  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| || ||| | |||   ||||||||||||||||||| |||||||||||||    
16722190 ttcctccacttttggtccctcattttacgtgtcatgtatgcagattctgcttacatggtggaataagggaccaaaagtggaagaatatgaaattacaggg 16722289  T
306 acaaaat 312  Q
    |||||||    
16722290 acaaaat 16722296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 30500419 - 30500114
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||||  |||||||| |||||||||| || ||||||||||||||| | |||||||||||  |    
30500419 agggtaaatacctcttttcgtccctgtaatattagcgaattccagttttagtccctgtaaaaaaaaa-atttagattttgtccctgtaatttcatattgt 30500321  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| |||||||||||||||||||||| |||||| ||| | |||||||||| |||||||||||| | |||||||||||||||| ||| |||||||||| |    
30500320 tccacttttggtccctcctttcatcacgtcagcaaaatctacataaattacatccctgtaatttcagattcctcccacttttggtccatgtaatttcaaa 30500221  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    ||||| || |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | |||   ||||||||||||||||||| |||||||||||||    
30500220 ttccttcacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtggtggaataagggaccaaaagtggaagaatatgaaattacaggg 30500121  T
306 acaaaat 312  Q
    |||||||    
30500120 acaaaat 30500114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 7 - 312
Target Start/End: Original strand, 21632900 - 21633201
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||     ||||||| |||||||||| ||||| ||||| |||||| | |||||||| || ||    
21632900 agggtaaatacctcttttcgtccctgtaatattagcgaatt-----tttagtccctgtaaaaaaaaagatctagatgttgtccctgtaatttcagattct 21632994  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    | || |||||||||||||||||||||  ||| |||||| ||||||||||||||||||||||||| | |||||||||||||||| ||| ||||||||||||    
21632995 ttcacttttggtccctcctttcatcaagtcaacagaatctgcataaattacgtccctgtaatttcagattcctcccacttttggtccttgtaatttcaga 21633094  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||| ||| |||| ||||||||| | || |||||| | ||||  |||||||||||||||||||||||||||||||||    
21633095 ttcctccacttttggtccctcattttatgtgccatgtatgcagattcttcttacgtggtggaatgagggaccaaaagtggaagaatctgaaattacaggg 21633194  T
306 acaaaat 312  Q
    |||||||    
21633195 acaaaat 21633201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 8 - 312
Target Start/End: Complemental strand, 19113143 - 19112838
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||||||||||| |||||| ||| |||| ||||||||| |||||||| |||||||||| |||||||||||||| ||| | |||||||| || |||    
19113143 gggtaaatacctcttttcgtccctataatattaacgaattccggttttagtccctgtaaaaaaaaagatttagattttatccctgtaatttcagattctt 19113044  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    | | |||||||||||||||||||||  ||| |||||| |||||||||||||||| |||||||| | |||||||||||||||| |||||||||||||||||    
19113043 ctacttttggtccctcctttcatcaagtcaacagaatctgcataaattacgtccttgtaatttcagattcctcccacttttggtccctgtaatttcagat 19112944  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    | ||||| |||| ||||||||||||||||  |||| ||||||||| |||| |||||| | |||   ||||||||||||||||||| ||||||| ||||||    
19112943 ttctccacttttggtccctcattttacgtaccatgtatgcagattctgcttacgtggtggaataagggaccaaaagtggaagaatatgaaattccaggga 19112844  T
307 caaaat 312  Q
    ||||||    
19112843 caaaat 19112838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 35996054 - 35995751
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtccta-taatttcatatgct 105  Q
    ||||| ||||| |||||| |||||||||| ||||||||||||||||||||||| |||||||||| ||   ||||| ||||||  | |||||||| || ||    
35996054 agggtaaatacatcttttcgtccctgtaatattagcgaattccgattttagtccctgtaaaaaaaaa---ttagaatttgtctcagtaatttcagattct 35995958  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| ||||||||||| |||||||||| || ||||||| |||||||||||||||| ||||  |||| |||||||||||||||  ||||||||||||||      
35995957 tccacttttggtcccttctttcatcacgtccgcagaatctgcataaattacgtccttgtatatttagattcctcccactttttgtccctgtaatttcatg 35995858  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggg 305  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | ||||  |||||||||||||||||||||||||||||||||    
35995857 ttcctccacttttggtccctcattttacgtgtcatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaagaatctgaaattacaggg 35995758  T
306 acaaaat 312  Q
    |||||||    
35995757 acaaaat 35995751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 52553061 - 52552765
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgcttccatt 111  Q
    ||||| |||||| |||| ||||| ||||||||||||   |||||||| |||||||||| ||||||||||||||||| || ||||||||||| |||||| |    
52553061 aatacatcttttcgtccttgtaatattagcgaattctagttttagtccctgtaaaaaaaaagatttagattttgtctctgtaatttcatattcttccact 52552962  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| | |||||||||    ||| |||||||||||||| ||||||     
52552961 tttggtccctcctttcatcacgtcagcagaatctgcataaattacgtccctgtaatttcagattcctccc----ttggtccctgtaatttcaaattcctt 52552866  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||| |||| ||||||||| |||| || ||| | |||   ||| |||||||||||||||||||||||||||||||||||    
52552865 cacttttggtccctcattttacgtgtcatgtatgcagattctgctgacatggtggaataagggatcaaaagtggaagaatctgaaattacagggacaaaa 52552766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 38283555 - 38283855
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgcttccatt 111  Q
    |||| |||||||  ||||||||| |||| ||||||||| ||||||||  ||||||||| || ||||||||||||| |||||||||||||||  ||||| |    
38283555 aatatctcttttcatccctgtaatattaacgaattccggttttagtccttgtaaaaaaaaaaatttagattttgttcctataatttcatattgttccact 38283654  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagattcctc 211  Q
    |||| |||||||||||||||| |||||||||| | ||||| ||||||||||||||||| | |||||||||||||||  ||| |||||||||| |||||||    
38283655 tttgatccctcctttcatcacgtcagcagaatctacataagttacgtccctgtaatttaagattcctcccactttttgtccgtgtaatttcaaattcctc 38283754  T
212 catttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagggacaaaa 311  Q
    || |||| ||||||||||||||||| |||| ||||||||| |||| |||||  |||||   ||| |||||||||||||||||||||||| ||||||||||    
38283755 cacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtgatgaaataagggatcaaaagtggaagaatctgaaattatagggacaaaa 38283854  T
312 t 312  Q
    |    
38283855 t 38283855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 20854075 - 20853769
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||| ||||||| |||| ||||| ||||||||||| || |||||||| |||||||||| |||||||||||||||||| | |||||||| || |    
20854075 tagggtaaatatctcttttcgtccatgtaatattagcgaatttcggttttagtc-ctgtaaaaaaaaagatttagattttgtccctgtaatttcagattc 20853977  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| |||||||||||||||||||||  ||| || ||| ||||||||||| ||| ||||||||| | ||||||||||||| || || ||||||||| ||    
20853976 ttccacttttggtccctcctttcatcaagtcaacataatctgcataaattatgtcactgtaatttcagattcctcccacttctggtctctgtaattttag 20853877  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||||||||| |||| ||||||||||||||||| |||| ||||||||| | || |||||| | ||||  ||||||||||||||||||| |||||||| |||    
20853876 attcctccacttttggtccctcattttacgtgccatgtatgcagattctacttacgtggtggaatgagggaccaaaagtggaagaatatgaaattatagg 20853777  T
305 gacaaaat 312  Q
    ||||||||    
20853776 gacaaaat 20853769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 6 - 312
Target Start/End: Original strand, 33372404 - 33372709
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||| ||||||| |||||||||| |||||||||||| | |||||||  ||||||| || |||||||||||||||||| | |||||||| ||      
33372404 tagggtaaatatctcttttcgtccctgtaatattagcgaattctggttttagttcctgtaaataaaaagatttagattttgtccctgtaatttcagatta 33372503  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||||| |||||||||||||||||||||| |||||| ||| ||||| ||||| |||| |||||||| | |||||||||||||||| || |||||||||||     
33372504 ttccacttttggtccctcctttcatcacgtcagcaaaatctgcatcaattaagtccttgtaatttcagattcctcccacttttggtctctgtaatttcat 33372603  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||||||||| ||||  |||||||||||||||| || | ||||||||| |||| |||||| | ||||| ||| ||||||||||||||||||||||||||||    
33372604 attcctccacttttgatccctcattttacgtgtca-gtatgcagattctgctgacgtggtggaatgg-ggatcaaaagtggaagaatctgaaattacagg 33372701  T
305 gacaaaat 312  Q
    ||||||||    
33372702 gacaaaat 33372709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 6 - 308
Target Start/End: Original strand, 43572387 - 43572692
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| ||||| |||||| || ||||||| ||||||||||| || |||||||| |||||||||  || ||||||||||||||| | |||||||| || |    
43572387 tagggtaaatacatcttttcgttcctgtaatattagcgaatttcggttttagtccctgtaaaaagaaaaatttagattttgtccctgtaatttcagattc 43572486  T
105 ttccatttttggtccctcctttcatca-ca--tcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaattt 201  Q
    ||||| ||||||||||||||||||||| ||  |||||||||| |||| || ||||||||||||||||| | |||||||||||||||| ||||||||||||    
43572487 ttccacttttggtccctcctttcatcatcaagtcagcagaatctgcacaa-ttacgtccctgtaatttcatattcctcccacttttggtccctgtaattt 43572585  T
202 cagattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattac 301  Q
    || ||| ||||| |||| ||||||||||||||||| |||  | ||||||| |||| |||||| ||||||  |||||||||||||||||||||||||||||    
43572586 caaattactccacttttggtccctcattttacgtgtcatttacgcagattctgctgacgtggtgaaatgagggaccaaaagtggaagaatctgaaattac 43572685  T
302 agggaca 308  Q
    |||||||    
43572686 agggaca 43572692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 6 - 302
Target Start/End: Original strand, 49986525 - 49986823
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataa-gatttagattttgtcc-tataatttcatatg 103  Q
    |||||| |||||||||||| |||||||||| ||||| |||||||| |||||||| |||||||||| || |||||||||||||||| | |||||||| ||     
49986525 tagggtaaatacctcttttcgtccctgtaatattagagaattccggttttagtcactgtaaaaaaaaaagatttagattttgtccctgtaatttcagatt 49986624  T
104 cttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttca 203  Q
    |||| | |||||||| ||||||||||||  | |  ||||| |||||||||||||||| |||||||| | ||||||| |||||||| ||||||||||||||    
49986625 cttctacttttggtctctcctttcatcaatttaatagaatctgcataaattacgtccttgtaatttcagattcctctcacttttggtccctgtaatttca 49986724  T
204 gattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattaca 302  Q
    |||||||||| |||| ||||||||||||||||  |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||| ||||||||||    
49986725 gattcctccacttttggtccctcattttacgtaccatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattaca 49986823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 15328463 - 15328765
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||||||||||| || ||||||| |||||  |||| || |||||||| |||||||||| ||   ||||||||||||| | ||||||||||| |||    
15328463 gggtaaatacctcttttcgttcctgtaatattagtaaatttcgtttttagtccctgtaaaaaaaaa---ttagattttgtccctgtaatttcatattctt 15328559  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    ||| |||  ||||||| ||||||||| ||| |||||| ||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||| ||    
15328560 ccagtttgtgtccctcttttcatcacgtcaacagaatctgcataaattacgtccctgtaatttcagattcctcccacttttggtccctgtaatttcaaat 15328659  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| |||| ||| ||||||||||||| |||  ||||||||| |||| |||||| | |||   ||||||||||||||| ||||||||||||||||||    
15328660 tcctccacttttggtctctcattttacgtgtcatatatgcagattctgctgacgtggtggaataagggaccaaaagtggaaaaatctgaaattacaggga 15328759  T
307 caaaat 312  Q
    ||||||    
15328760 caaaat 15328765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 45003496 - 45003801
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||| |||| ||||||| ||||| |||| |||||| ||||||| ||| |||| || ||||| | |||||||||||||||||| | |||||||| || |||    
45003496 gggtaaatatctcttttcgtccccgtaatattagcaaattccggtttcagtccctataaaataaaagatttagattttgtccctgtaatttcagattctt 45003595  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcagat 206  Q
    ||| |||| ||||||||||||||||| ||| |||||| || ||||||||||||| |||||||| | |||||||||||||||| |||||||||||||| ||    
45003596 ccactttttgtccctcctttcatcacgtcaacagaatctgtataaattacgtccttgtaatttcagattcctcccacttttgttccctgtaatttcatat 45003695  T
207 tcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacaggga 306  Q
    ||||||| ||||  ||||||||||||| || |||| ||||||||| |||| |||||| | ||||  ||||||||||||||||||| |||||||| |||||    
45003696 tcctccacttttgatccctcattttacatgccatgtatgcagattctgcttacgtggtggaatgagggaccaaaagtggaagaatatgaaattataggga 45003795  T
307 caaaat 312  Q
    | ||||    
45003796 ctaaat 45003801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 9267354 - 9267048
Alignment:
6 tagggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgc 104  Q
    |||||| |||||||||||| |||| ||||| ||||||||||||||||||||||| ||||| | || |   |||||||||||||| | |||| ||| || |    
9267354 tagggtaaatacctcttttcgtccttgtaatattagcgaattccgattttagtccctgtatataa-attttttagattttgtccctgtaatatcagattc 9267256  T
105 ttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcag 204  Q
    ||| | |||||||||||||||||||||  ||| |||||| ||||||||||| |||| |||||||| | |||||||||||||||| ||| |||||||||||    
9267255 ttctacttttggtccctcctttcatcaagtcaacagaatctgcataaattaagtccttgtaatttcagattcctcccacttttggtccttgtaatttcag 9267156  T
205 attcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    ||||||||| |||| ||||||||||||||||   ||| ||||||||| |||| |||||  | ||||  ||||||||||||||||||| ||||||||||||    
9267155 attcctccacttttggtccctcattttacgtacaatgtatgcagattctgcttacgtgctggaatgagggaccaaaagtggaagaatatgaaattacagg 9267056  T
305 gacaaaat 312  Q
    ||||||||    
9267055 gacaaaat 9267048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 7 - 304
Target Start/End: Complemental strand, 17465746 - 17465449
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgct 105  Q
    ||||| |||||||||||| |||| ||||| ||||||||||| |  ||||| ||||||||||| | || ||||| ||||||||| | ||| || | || ||    
17465746 agggtaaatacctcttttcgtccttgtaatattagcgaatttcagttttaatctctgtaaaataaaatatttaaattttgtccctgtaactttagattct 17465647  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    | || |||||||||||||||||||||| ||| || ||| | ||||||||||||| ||||||||| | |||||||||||||||| ||| |||||||||| |    
17465646 ttcacttttggtccctcctttcatcacgtcaacaaaatttacataaattacgtctctgtaatttcagattcctcccacttttggtcc-tgtaatttcata 17465548  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattacagg 304  Q
    |||||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| | ||||   || ||||| ||||||||||||||||||||||    
17465547 ttcctccacttttggtccctcattttacgtgccatgtatgcagattctgcttacgtggtggaatgagagatcaaaaatggaagaatctgaaattacagg 17465449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 7 - 220
Target Start/End: Original strand, 11003731 - 11003945
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtccta-taatttcatatgct 105  Q
    ||||| ||||||||||||||||| ||||| |||| ||||||||| |||||||| ||||||| || |||| ||||||||||||||  |||||||| || ||    
11003731 agggtaaatacctctttttgtccttgtaatattaccgaattccggttttagtccctgtaaataaaaagacttagattttgtccttgtaatttcagattct 11003830  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    |||| ||||||||| |||||||||||  ||| || ||||||||| ||||||||||||||||||| | |||||||||||||||| ||||||||||||||||    
11003831 tccacttttggtccatcctttcatcaagtcaacaaaatatgcatcaattacgtccctgtaatttcagattcctcccacttttggtccctgtaatttcaga 11003930  T
206 ttcctccatttttag 220  Q
    |||||||| ||||||    
11003931 ttcctccacttttag 11003945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 94 - 308
Target Start/End: Complemental strand, 4204999 - 4204785
Alignment:
94 atttcatatgcttccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccc 193  Q
    |||||| || |||||| ||||| |||||| ||| ||||| |||| ||||| |||||||||||| ||| | |||||| | |||||||||||| ||| || |    
4204999 atttcagattcttccacttttgatccctctttttatcacgtcagtagaatctgcataaattacatccatataatttcagattcctcccactattggtctc 4204900  T
194 tgtaatttcagattcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatct 293  Q
    |||||||||| ||| ||||| |||| ||||||||||||||||| |||| ||||||||| |||| |||||| ||||||  |||||||||||||||||||||    
4204899 tgtaatttcatattactccacttttggtccctcattttacgtgccatgtatgcagattctgctgacgtggtgaaatgagggaccaaaagtggaagaatct 4204800  T
294 gaaattacagggaca 308  Q
    |||||||||||||||    
4204799 gaaattacagggaca 4204785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 7 - 302
Target Start/End: Complemental strand, 47575650 - 47575356
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtc-ctataatttcatatgct 105  Q
    ||||| ||||||||| || ||| | |||| || || |||||| | |||||||| |||||||||| || ||| |||||||||| || |||||||| ||  |    
47575650 agggtaaatacctctattcgtctccgtaatatgagtgaattctggttttagtccctgtaaaaaaaaaaatt-agattttgtctctgtaatttcagatttt 47575552  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattttaaattcctcccacttttgatccctgtaatttcaga 205  Q
    || | |||||||| ||||||||||||| |||||||||| |||||||||||  |||||||||||| |||||||||||| ||||  |||||||||||||| |    
47575551 tcaacttttggtctctcctttcatcacgtcagcagaatctgcataaattatatccctgtaatttcaaattcctcccattttttgtccctgtaatttcaaa 47575452  T
206 ttcctccatttttagtccctcattttacgtgncatgnatgcagattttgctaacgtggngaaatggaggaccaaaagtggaagaatctgaaattaca 302  Q
    |||||||| ||||  |||||||||||||||| |||| ||||||||| ||||  ||||| | ||| | |||||||||||| |||||| | ||||||||    
47575451 ttcctccacttttgatccctcattttacgtgccatgtatgcagattctgctgccgtggtggaatag-ggaccaaaagtgaaagaatataaaattaca 47575356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 9266974 - 9267118
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    ||||| |||||||||||| |||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||| ||| ||||||||||| ||    
9266974 agggtaaatacctcttttcgtccctgtaatattagcgaattccggttttagtccctgtaaaaaaaaagatttagattttgtccctgtaatttcatattct 9267073  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||| || || ||| | |||||||| ||||||    
9267074 tccacttttggtccctcattccagcacgtaagcagaatctgcata 9267118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 14262035 - 14262179
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    |||||||||| ||||||| |||||||||| |||||||||||||| ||||||||  ||||||||| || ||||||||||||| ||| |||||||| || ||    
14262035 agggttaatatctcttttcgtccctgtaatattagcgaattccggttttagtccttgtaaaaaaaaatatttagattttgtccctgtaatttcagattct 14262134  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| |||||||||||  || || |||||||||||||| ||||||    
14262135 tccacttttggtcccttattccaccacatcagcagaatctgcata 14262179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 8 - 150
Target Start/End: Complemental strand, 5800982 - 5800840
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    ||||||||||||||||| |||||||||| ||||||||||||||  ||||||| |||||||||| |||||||||||||||||| | ||||||||||| |||    
5800982 gggttaatacctcttttcgtccctgtaatattagcgaattccg-gtttagtccctgtaaaaaaaaagatttagattttgtccttgtaatttcatattctt 5800884  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||| |||||||||||  || || ||| |||||| ||| ||||||    
5800883 ccacttttggtcccttattccaccacttcagcaaaatttgcata 5800840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 8 - 150
Target Start/End: Complemental strand, 14162248 - 14162106
Alignment:
8 gggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgctt 106  Q
    |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||  ||||||||||||||||| | |||||||| || |||    
14162248 gggttaatacctctttttgtccctgtaatattagcgaattccggttttagtccctgtaaaaaa-gagatttagattttgtccttgtaatttcagattctt 14162150  T
107 ccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    ||| |||||||||||  || || ||| |||||| ||| ||||||    
14162149 ccacttttggtcccttattccaccacgtcagcaaaatttgcata 14162106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 14171586 - 14171729
Alignment:
7 agggttaatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgt-cctataatttcatatgct 105  Q
    ||||| |||||| ||||| |||||||||| |||||||||||||||||||| | ||||||||||| |||||||||||||||| ||| |||||||| || ||    
14171586 agggtaaataccacttttcgtccctgtaatattagcgaattccgattttaatttctgtaaaaaa-aagatttagattttgtccctgtaatttcaaattct 14171684  T
106 tccatttttggtccctcctttcatcacatcagcagaatatgcata 150  Q
    |||| ||||| |||||| || || ||| |||||||||| ||||||    
14171685 tccacttttgatccctcattccaccacgtcagcagaatctgcata 14171729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 13 - 169
Target Start/End: Complemental strand, 17649382 - 17649226
Alignment:
13 aatacctctttttgtccctgtaaaattagcgaattccgattttagtctctgtaaaaaataagatttagattttgtcc-tataatttcatatgcttccatt 111  Q
    |||||||||||| | |||||||| | |||||||||||| |||||||  ||| |||||| |||||||||||||||||| | |||||||| ||  |||||      
17649382 aatacctcttttcgaccctgtaatactagcgaattccggttttagttcctggaaaaaa-aagatttagattttgtccctgtaatttcagattattccaca 17649284  T
112 tttggtccctcctttcatcacatcagcagaatatgcataaattacgtccctgtaattt 169  Q
    ||||||| ||||||| ||||  ||| |||||| |||||||||||||||||||||||||    
17649283 tttggtctctccttttatcaagtcaacagaatctgcataaattacgtccctgtaattt 17649226  T

Back To: