View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L4_35 (Length: 633)

Name: R108-L4_35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L4_35
R108-L4_35
[»] chr3 (1 HSPs)
chr3 (1-447)||(332539-332983)


Alignment Details
Target: chr3 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 447
Target Start/End: Complemental strand, 332983 - 332539
Alignment:
1 aaaagtacatcaaagtgatgaactaatgaaaattggaatggaacaagaggattgccccaaggtttctgacccaagattttcaaaatgtggattagcactt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||||||||||||||||||||    
332983 aaaagtacatcaaagtgatgaactaatgaaaattggaatggaacaagaggattgcaaaaaagtttctgacccaagattttcaaaatgtggattagcactt 332884  T
101 aaaggatttccaagtgaaatttatgatgtggaatgggatgtgatcatggtggatgcaccaacggggtacttcgatggcgcgccggggaggatgagtgcta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
332883 aaaggatttccaagtgaaatttatgatgtggaatgggatgtgatcatggtggatgcaccaacggggtacttcgatggcgcgccggggaggatgagtgcta 332784  T
201 tttatacagctggtttgattgctaggaatagagaaaatggtgatactgatgtgtttgttcatgatgttggtaggaaagttgaggatccattttcaaaggc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||    
332783 tttatacagctggtttgattgctaggaatagagaaaatggtgatactgatgtgtttgttcatgatgttgataggaaagttgaggatcaattttcaaaggc 332684  T
301 ttttctttgtgaaggttatttgagggaacaagaaggaaggattangcacttccatataccnagtcntagggctcgcttgggtagaccccattgtccntga 400  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||| ||||||||| |||||||||||  ||||||| |||    
332683 ttttctttgtgaaggttatttgagggaacaagaaggaaggattaggcacttcaatataccaagtcatagggctcgtttgggtagaccttattgtccatga 332584  T
401 aattgattttggatcaaatctcnttcaaaccattatgccaattatta 447  Q
    |||||||||||||||| ||||| |||||| ||||||| |||||||||    
332583 aattgattttggatcagatctcattcaaa-cattatg-caattatta 332539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110473 times since January 2019
Visitors: 1335