View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L4_39 (Length: 473)

Name: R108-L4_39
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L4_39
R108-L4_39
[»] chr3 (1 HSPs)
chr3 (1-247)||(332979-333225)


Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 332979 - 333225
Alignment:
1 cttttgtatcatacacaacatgatatgattccaacgttgggaactttgattggatttgctcaatccatgtcttgtcttcttcaaggaaaacggtccggcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
332979 cttttgtatcatacacaacatgatatgattccaacgttgggaactttgattggatttgctcaatccatgtcttgtcttcttcaaggaaaacggtccggcc 333078  T
101 gccgtagtttaatgatgtccacatgagactatcatgacctaatccaaagaccaagaagttgcaaggtgannnnnnnngaagaactttggctgagactgag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||    
333079 gccgtagtttaatgatgtccacatgagactatcatgacctaatccaaagaccaagaagttgcaaggtgattttttttgaagaactttggctgagactgag 333178  T
201 atctcttgaattgtttgttgaggggtgatttttgttgntgcntaatg 247  Q
    ||||||||||||||||||||||||||||||||||||| ||| |||||    
333179 atctcttgaattgtttgttgaggggtgatttttgttgttgcataatg 333225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108371 times since January 2019
Visitors: 1329