View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L4_6 (Length: 902)

Name: R108-L4_6
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L4_6
R108-L4_6
[»] chr3 (15 HSPs)
chr3 (242-559)||(24928789-24929111)
chr3 (622-763)||(24928647-24928790)
chr3 (14-124)||(24929240-24929351)
chr3 (762-858)||(24346122-24346218)
chr3 (762-858)||(28255128-28255224)
chr3 (762-858)||(43884984-43885080)
chr3 (752-846)||(50675591-50675685)
chr3 (762-843)||(37516067-37516148)
chr3 (762-843)||(39128147-39128228)
chr3 (762-837)||(52796717-52796792)
chr3 (762-858)||(52099702-52099798)
chr3 (754-833)||(44430092-44430170)
chr3 (808-858)||(44384439-44384489)
chr3 (802-841)||(37324905-37324944)
chr3 (762-791)||(44385279-44385308)
[»] chr8 (6 HSPs)
chr8 (764-902)||(20812501-20812636)
chr8 (754-843)||(2116479-2116568)
chr8 (762-853)||(31666247-31666338)
chr8 (811-858)||(31251853-31251900)
chr8 (754-841)||(38783629-38783716)
chr8 (763-837)||(27631579-27631652)
[»] chr1 (8 HSPs)
chr1 (762-856)||(45708016-45708110)
chr1 (762-858)||(10616165-10616261)
chr1 (754-846)||(11240605-11240695)
chr1 (762-841)||(42596363-42596442)
chr1 (762-858)||(41122677-41122771)
chr1 (754-843)||(52860534-52860623)
chr1 (762-837)||(50366171-50366246)
chr1 (762-830)||(14591459-14591525)
[»] scaffold0069 (1 HSPs)
scaffold0069 (765-902)||(36038-36172)
[»] chr4 (6 HSPs)
chr4 (754-858)||(39843500-39843604)
chr4 (762-853)||(53921100-53921191)
chr4 (762-858)||(42857607-42857701)
chr4 (762-843)||(11671790-11671871)
chr4 (801-837)||(47499452-47499488)
chr4 (762-841)||(52399246-52399325)
[»] chr7 (4 HSPs)
chr7 (754-843)||(45657670-45657757)
chr7 (754-841)||(16871463-16871550)
chr7 (762-857)||(34996703-34996798)
chr7 (55-115)||(33249474-33249535)
[»] chr5 (4 HSPs)
chr5 (762-858)||(29993127-29993223)
chr5 (762-853)||(12464191-12464282)
chr5 (762-843)||(24905380-24905459)
chr5 (763-831)||(6377488-6377556)
[»] chr2 (4 HSPs)
chr2 (762-858)||(37472294-37472388)
chr2 (752-843)||(11738615-11738706)
chr2 (762-841)||(3462680-3462759)
chr2 (801-843)||(28634546-28634588)
[»] chr6 (3 HSPs)
chr6 (762-858)||(251872-251968)
chr6 (762-846)||(5045499-5045583)
chr6 (762-854)||(7214509-7214601)
[»] scaffold0072 (1 HSPs)
scaffold0072 (762-846)||(46599-46683)


Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-145; HSPs: 15)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-145
Query Start/End: Original strand, 242 - 559
Target Start/End: Complemental strand, 24929111 - 24928789
Alignment:
242 acaactaacacacccttagggaacaaatcatggattatctgcaacaaatcaattcaatcattacaagtatacttacccaatcgagtagcaccaacccaat 341  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24929111 acaactaacacacccttagggaacaaatcatggattatctgcaacaaatcaattcaatcattacaagtatacttacccaatcgagtagcaccaacccaat 24929012  T
342 tcctatgcttggggtatgaaccgagtacaccattatgtactgaacaagctcttcgaaatatgattaaagtaaccgagagtgatttggatgattncattga 441  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||    
24929011 tcctatgcttggggtatgaaccgagtacaccattatgtactgaacaagctcttcgaaatatgattaaagtaaccgagagtgatttggatgacttcattga 24928912  T
442 gtttacgagagtatatggagatcaagagccatgctctt--------atatcctgggtgggagcttaacgaaaaattcgaacttaggaagacagcaggnaa 533  Q
    |||||||||||||||||||||||||||| |||||||||        |||| |||||||||||||||||||||||||||||||||||||||||||||| ||    
24928911 gtttacgagagtatatggagatcaagag-catgctcttcttttgagatat-ctgggtgggagcttaacgaaaaattcgaacttaggaagacagcagg-aa 24928815  T
534 acctctcaagccatagctttggagga 559  Q
    ||||||||||| ||||||||||||||    
24928814 acctctcaagctatagctttggagga 24928789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 130; E-Value: 7e-67
Query Start/End: Original strand, 622 - 763
Target Start/End: Complemental strand, 24928790 - 24928647
Alignment:
622 gatgttgaaggtgatgaggaagaaaaacaccattacctacctgtagtaactcatctattagaacaagatccttggttctttttcttttatagtgtgtttg 721  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24928790 gatgttgaaggtgatgaggaagaaaaacaccattacctacctgtagtaactcatctattagaacaagatccttggttctttttcttttatagtgtgtttg 24928691  T
722 gttggaaggaaagttgtcaaga--gagangtcaaaaatatatta 763  Q
    ||||||||||||||||||||||  |||| |||||||||||||||    
24928690 gttggaaggaaagttgtcaagagagagatgtcaaaaatatatta 24928647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 14 - 124
Target Start/End: Complemental strand, 24929351 - 24929240
Alignment:
14 attaattcatatatgaaatccttttnnnnnnnnttatatgactaagataatcaagttgtgtattagttttttaatataaggatatttgagtcttttcaa- 112  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
24929351 attaattcatatatgaaatccttttaaaaaaaattatatgactaagataatcaagttgtatattagttttttaatataaggatatttgagtcttttcaaa 24929252  T
113 aaaattgttgca 124  Q
    ||||||||||||    
24929251 aaaattgttgca 24929240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 24346218 - 24346122
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||||||||||||||||||| ||| ||| ||| |||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||    
24346218 tagatttgatgtgttgtttggtataagagagatatgagagaaatagaagagagagaagtgttgattatttataaaagtactaagatgcccctacaat 24346122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 28255224 - 28255128
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||||||||||||||||||| ||| ||| ||| |||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||    
28255224 tagatttgatgtgttgtttggtataagagagatatgagagaaatagaagagagagaagtgttgattatttataaaagtactaagatgcccctacaat 28255128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 762 - 858
Target Start/End: Original strand, 43884984 - 43885080
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||||||||||||||||||| ||| ||| ||| |||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||    
43884984 tagatttgatgtgttgtttggtataagagagatatgagagaaatagaagagagagaagtgttgattatttataaaagtactaagatgcccctacaat 43885080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 752 - 846
Target Start/End: Complemental strand, 50675685 - 50675591
Alignment:
752 aaaaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaaga 846  Q
    ||||||| | ||||||||||||||||||| |||||||||| | | ||| |||||| |||| |||||| |||||||||||||||||||||||||||    
50675685 aaaaataaaatagatttgatgtgttgtttagtataaaagagagaagagagaaatagaagatagagaaatgttgattatttataaaagtactaaga 50675591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 762 - 843
Target Start/End: Original strand, 37516067 - 37516148
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    |||||||||||| |||||| |||||||||| ||| ||| |||||| |||||||| ||||||||||||||||||||| |||||    
37516067 tagatttgatgtattgttttgtataaaagaaatatgagagaaatagaagagagaaaagtgttgattatttataaaattacta 37516148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 762 - 843
Target Start/End: Original strand, 39128147 - 39128228
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    |||||||||||| |||||||||| || ||| | | ||| |||||| ||||||||||| |||||||||| |||||||||||||    
39128147 tagatttgatgtattgtttggtaaaagagagagatgagagaaatagaagagagagaaatgttgattatatataaaagtacta 39128228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 762 - 837
Target Start/End: Complemental strand, 52796792 - 52796717
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaa 837  Q
    |||||||||||| ||||||| ||||| ||| | ||||| |||| | ||||||||||| ||||||||||||||||||    
52796792 tagatttgatgtcttgtttgttataagagagagacgagagaaaaagaagagagagaaatgttgattatttataaaa 52796717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 52099798 - 52099702
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    ||||||||||| |||||||| ||||| ||| | | ||| |||||| |||| | | ||||||| ||||||||||||||||| ||||  ||||||||||    
52099798 tagatttgatgagttgtttgttataagagagagatgagagaaatagaagaaaaataagtgttaattatttataaaagtaccaagatgcccctacaat 52099702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 754 - 833
Target Start/End: Original strand, 44430092 - 44430170
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttat 833  Q
    ||||||| |||||||||||| ||||||||| ||| ||| ||| ||| |||||| |||| |||||| ||||||||||||||    
44430092 aaatatagtagatttgatgtattgtttggt-taagagagatatgagagaaatagaagaaagagaaatgttgattatttat 44430170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 808 - 858
Target Start/End: Complemental strand, 44384489 - 44384439
Alignment:
808 aagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    ||||||||||| ||||||||||||||||||||| ||||| ||| |||||||    
44384489 aagagagagaaatgttgattatttataaaagtattaagatacctctacaat 44384439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 802 - 841
Target Start/End: Original strand, 37324905 - 37324944
Alignment:
802 aaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||| |||||||||||||||||||||||| |||||||||    
37324905 aaatagaagagagagaagtgttgattatttttaaaagtac 37324944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 762 - 791
Target Start/End: Complemental strand, 44385308 - 44385279
Alignment:
762 tagatttgatgtgttgtttggtataaaaga 791  Q
    ||||||||||||||||||||||||||||||    
44385308 tagatttgatgtgttgtttggtataaaaga 44385279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 2e-27; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 764 - 902
Target Start/End: Complemental strand, 20812636 - 20812501
Alignment:
764 gatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaatnnnnn 863  Q
    |||||||||||||||||||| ||| ||| | | ||| |||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||         
20812636 gatttgatgtgttgtttggtgtaagagagagatgagagaaatagaagagagagaagtgttgattatttataaaagtactaagatgcccctacaat---aa 20812540  T
864 nnnnntatctattaaaattatttaatcttttattcaaat 902  Q
         |||| |||||||||||||||||||||||||||||    
20812539 aaagatatccattaaaattatttaatcttttattcaaat 20812501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 754 - 843
Target Start/End: Complemental strand, 2116568 - 2116479
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    ||||||| |||||||||||||||||||| ||||| ||| | | ||| |||||| ||||||||||||||||||||||||||||||||||||    
2116568 aaatatagtagatttgatgtgttgtttgttataagagagagatgagagaaatagaagagagagaagtgttgattatttataaaagtacta 2116479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 762 - 853
Target Start/End: Original strand, 31666247 - 31666338
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccct 853  Q
    |||||||||||| ||||||||||||||||| | | ||| |||||| |||||||||||||||||||||||||||||| ||||| || ||||||    
31666247 tagatttgatgtattgtttggtataaaagaaagatgagagaaatagaagagagagaagtgttgattatttataaaattactatgatacccct 31666338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 811 - 858
Target Start/End: Complemental strand, 31251900 - 31251853
Alignment:
811 agagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    ||||||||||||||||||||||||||||||||||||  ||||||||||    
31251900 agagagaagtgttgattatttataaaagtactaagatgcccctacaat 31251853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 754 - 841
Target Start/End: Complemental strand, 38783716 - 38783629
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||||| |||||||||||  ||||||||||||| ||| | || |  |||||| |  ||||||||||||||||||| | |||||||||    
38783716 aaatatagtagatttgatgaattgtttggtataagagaaagacaaaagaaatagagaagagagaagtgttgattatatctaaaagtac 38783629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 763 - 837
Target Start/End: Original strand, 27631579 - 27631652
Alignment:
763 agatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaa 837  Q
    ||||||||||| ||||||||||||||||| | | ||| |||||| |||||| |||| |||| ||||||| |||||    
27631579 agatttgatgtattgtttggtataaaagaaagaagagagaaatagaagagaaagaaatgtt-attatttttaaaa 27631652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 7e-27; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 7e-27
Query Start/End: Original strand, 762 - 856
Target Start/End: Original strand, 45708016 - 45708110
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctaca 856  Q
    ||||| |||||||||||||||||||| ||| | | ||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
45708016 tagatctgatgtgttgtttggtataagagagagatgagagaaatagaagagagagaagtgttgattatttataaaagtactaagatacccctaca 45708110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 10616261 - 10616165
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||||||||||||| ||||| ||| | | ||| |||||| ||||||| |||||||||||||||||||||||||||||||  ||||||||||    
10616261 tagatttgatgtgttgtttgttataagagagagatgagagaaatagaagagagtgaagtgttgattatttataaaagtactaagatgcccctacaat 10616165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 754 - 846
Target Start/End: Complemental strand, 11240695 - 11240605
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaaga 846  Q
    ||||||| ||||| |||||||||||||| ||||| ||| | | ||| |||||| ||||||||  ||||||||||||||||||||||| |||||    
11240695 aaatatagtagatatgatgtgttgtttgttataagagagagatgagagaaatagaagagaga--agtgttgattatttataaaagtattaaga 11240605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 762 - 841
Target Start/End: Original strand, 42596363 - 42596442
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||||||| |||||||||| ||||||||| | | | | |||||| |||||| ||||||||| ||||| |||||||||||    
42596363 tagatttgaggtgttgtttgttataaaagaaagatgggagaaatagaagagaaagaagtgttaattatatataaaagtac 42596442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 41122771 - 41122677
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||| ||| ||||||||||||| ||| ||  ||| |||||| ||||||||||||||||| | |||| ||||| ||||||   |||||||||||    
41122771 tagatttgttgtattgtttggtataagagagat--gagagaaatagaagagagagaagtgttggtcatttgtaaaactactaaattacccctacaat 41122677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 754 - 843
Target Start/End: Complemental strand, 52860623 - 52860534
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    ||||||| ||||||||||| |||||||||||||||||| | | |||  ||||| |  |||||||||||||  |||| | |||||||||||    
52860623 aaatatagtagatttgatgggttgtttggtataaaagagaaatgagataaatagagaagagagaagtgttttttatatttaaaagtacta 52860534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 762 - 837
Target Start/End: Complemental strand, 50366246 - 50366171
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaa 837  Q
    |||||||||||| |||||||| || | ||||| | ||| |||||  |||||| ||||||||||||| |||||||||    
50366246 tagatttgatgtattgtttggaatgagagatagatgagagaaattgaagagaaagaagtgttgattgtttataaaa 50366171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 762 - 830
Target Start/End: Complemental strand, 14591525 - 14591459
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatt 830  Q
    |||||||||||| ||||||| ||||||||| ||| ||  |||||| |  ||||||||||||||||||||    
14591525 tagatttgatgtattgtttgatataaaagagatatgaaagaaatata--agagagaagtgttgattatt 14591459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069 (Bit Score: 59; Significance: 2e-24; HSPs: 1)
Name: scaffold0069
Description:

Target: scaffold0069; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 765 - 902
Target Start/End: Original strand, 36038 - 36172
Alignment:
765 atttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaatnnnnnn 864  Q
    ||||||||||||||||||||||| ||| | | |||  ||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||          
36038 atttgatgtgttgtttggtataagagagagatgagataaatagaagagagagaagtgttgattatttataaaagtactaagatgcccctacaat---aaa 36134  T
865 nnnntatctattaaaattatttaatcttttattcaaat 902  Q
        | || |||||||||||||||||||||||||||||    
36135 aaaatgtcaattaaaattatttaatcttttattcaaat 36172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 2e-23; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 754 - 858
Target Start/End: Complemental strand, 39843604 - 39843500
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccct 853  Q
    ||||||| |||||||||||||||||||| ||||| ||| | | | | |||||| |||||||| ||||||||||||||||||||||||||||||  |||||    
39843604 aaatatagtagatttgatgtgttgtttgttataagagagagatgggagaaatagaagagagataagtgttgattatttataaaagtactaagatgcccct 39843505  T
854 acaat 858  Q
    |||||    
39843504 acaat 39843500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 762 - 853
Target Start/End: Complemental strand, 53921191 - 53921100
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccct 853  Q
    |||||||||||||||||||| | ||||||| | |  || |||||| |||||||||||||||||||||| | ||||| |||||| | ||||||    
53921191 tagatttgatgtgttgtttgatttaaaagagagagaagagaaatagaagagagagaagtgttgattatatttaaaaatactaaaatacccct 53921100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 762 - 858
Target Start/End: Original strand, 42857607 - 42857701
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||||| ||||||||| ||| ||| | | ||| |||||| |||||  ||||||||||||||||||||||| ||||||   |||||||||||    
42857607 tagatttgatgtattgtttggtgtaagagagagatgagagaaatagaagag--agaagtgttgattatttataaaactactaaattacccctacaat 42857701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 762 - 843
Target Start/End: Complemental strand, 11671871 - 11671790
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    |||||||||||  ||||||||||||||||| | | ||| |||||| |  |||||||||||||| |||| | |||||||||||    
11671871 tagatttgatgaattgtttggtataaaagagaaatgagagaaatagagaagagagaagtgttgtttatatttaaaagtacta 11671790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 801 - 837
Target Start/End: Complemental strand, 47499488 - 47499452
Alignment:
801 gaaataaaagagagagaagtgttgattatttataaaa 837  Q
    ||||||||||||||||||||||||||||| |||||||    
47499488 gaaataaaagagagagaagtgttgattatatataaaa 47499452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 762 - 841
Target Start/End: Complemental strand, 52399325 - 52399246
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||||||||||  |||||||||||| ||| | |  || ||||||||  ||||||||||||||||| || ||||||||||    
52399325 tagatttgatgtagtgtttggtataagagaaagagaagagaaataaagaagagagaagtgttgattgttaataaaagtac 52399246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 4e-22; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 754 - 843
Target Start/End: Complemental strand, 45657757 - 45657670
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    ||||||| |||||||||||||||||||| ||||| ||| ||  ||| |||||| ||||||||||||||||||||||||||||||||||||    
45657757 aaatatagtagatttgatgtgttgtttgttataagagagat--gagagaaatagaagagagagaagtgttgattatttataaaagtacta 45657670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 754 - 841
Target Start/End: Complemental strand, 16871550 - 16871463
Alignment:
754 aaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||||| ||||||||| |||||||||| ||||| ||| | | ||| |||||| |||||| ||||||||| ||||| |||||||||||    
16871550 aaatatagtagatttgaggtgttgtttgttataagagaaagatgagagaaatagaagagaaagaagtgttaattatatataaaagtac 16871463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 762 - 857
Target Start/End: Complemental strand, 34996798 - 34996703
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaa 857  Q
    |||||||||||| ||||||||||||| ||| | |  || |||||| |  ||||||||||||| | ||||  |||||| ||||| ||||||||||||    
34996798 tagatttgatgtattgtttggtataagagagaaagaagagaaatagagaagagagaagtgtttaatattattaaaaggactaaaacacccctacaa 34996703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 115
Target Start/End: Original strand, 33249474 - 33249535
Alignment:
55 ctaagataatcaagttgtgtattagttt-tttaatataaggatatttgagtcttttcaaaaa 115  Q
    |||||| ||| || |||| ||||||||| ||||||||||| |||||| ||||||||||||||    
33249474 ctaagaaaataaaattgtatattagtttgtttaatataagaatattttagtcttttcaaaaa 33249535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 6e-21; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 762 - 858
Target Start/End: Complemental strand, 29993223 - 29993127
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    ||||||||||||||||||||| |||||||  | |  || || ||| |||||||||||||||||||||||||||||||||| |||| |||||||||||    
29993223 tagatttgatgtgttgtttggcataaaagggagaaaagagagatagaagagagagaagtgttgattatttataaaagtacaaagatacccctacaat 29993127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 762 - 853
Target Start/End: Complemental strand, 12464282 - 12464191
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccct 853  Q
    |||||||||||||||||||||| ||||||| | |  || |||||| || ||||||||||||||||||| | ||||| |||||| | ||||||    
12464282 tagatttgatgtgttgtttggtttaaaagagagagaagagaaatagaaaagagagaagtgttgattatgtttaaaaatactaaaatacccct 12464191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 762 - 843
Target Start/End: Complemental strand, 24905459 - 24905380
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    |||||||||||| |||||||||| || ||| | | ||| |||||||||||||||  |||||||||||| |||||||||||||    
24905459 tagatttgatgtattgtttggtaaaagagagagaagagagaaataaaagagaga--agtgttgattatatataaaagtacta 24905380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 763 - 831
Target Start/End: Original strand, 6377488 - 6377556
Alignment:
763 agatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattattt 831  Q
    ||||||||||||||||||||||||| ||| | | |||  ||||| |||||| |||||||||||||||||    
6377488 agatttgatgtgttgtttggtataagagaaaaaagagaaaaatagaagagaaagaagtgttgattattt 6377556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 4e-19; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 762 - 858
Target Start/End: Original strand, 37472294 - 37472388
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    ||||||||||| |||||||| ||||||||| ||  ||| |||||| |||||| ||||||||||||||||||||||| ||| |||| |||||||||||    
37472294 tagatttgatgggttgtttgttataaaagagat--gagagaaatagaagagaaagaagtgttgattatttataaaaataccaagatacccctacaat 37472388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 752 - 843
Target Start/End: Original strand, 11738615 - 11738706
Alignment:
752 aaaaatatattagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    ||||||| | |||||||||||  ||||||||||||||||| | | ||| |||||| |  |||||||||||||| |||| | |||||||||||    
11738615 aaaaatagagtagatttgatggattgtttggtataaaagagaaatgagagaaatagagaagagagaagtgttgtttatatttaaaagtacta 11738706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 762 - 841
Target Start/End: Original strand, 3462680 - 3462759
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtac 841  Q
    ||||||||||||  |||||||||||| ||| | |  || ||||||||  ||||||||||||||||| || ||||||||||    
3462680 tagatttgatgtagtgtttggtataagagaaagagaagagaaataaagaagagagaagtgttgattgttaataaaagtac 3462759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 801 - 843
Target Start/End: Original strand, 28634546 - 28634588
Alignment:
801 gaaataaaagagagagaagtgttgattatttataaaagtacta 843  Q
    |||||| |||||||||||||||||||||| | |||||||||||    
28634546 gaaatagaagagagagaagtgttgattatatctaaaagtacta 28634588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000009; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 762 - 858
Target Start/End: Original strand, 251872 - 251968
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacacccctacaat 858  Q
    |||||||||| ||||||||| ||||| ||| | | ||| |||||| |||||| | ||||||||||||||||||||||||  ||||  ||||||||||    
251872 tagatttgatttgttgtttgttataagagagagatgagagaaatagaagagaaaaaagtgttgattatttataaaagtatcaagatgcccctacaat 251968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 762 - 846
Target Start/End: Original strand, 5045499 - 5045583
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaaga 846  Q
    ||||||| |||  ||||||| ||||| ||| | | ||| |||||| |||||| ||||||||||||||||||||||||||| ||||    
5045499 tagattttatggattgtttgttataagagagagatgagagaaatagaagagaaagaagtgttgattatttataaaagtaccaaga 5045583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 762 - 854
Target Start/End: Complemental strand, 7214601 - 7214509
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaagacaccccta 854  Q
    ||||||||||  |||||||||||||| ||| |||  || ||||| || |||| |||| |||||||||||| ||||||||| || | |||||||    
7214601 tagatttgataagttgtttggtataagagagataaaagagaaatgaaggagaaagaaatgttgattatttttaaaagtacaaatataccccta 7214509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 762 - 846
Target Start/End: Original strand, 46599 - 46683
Alignment:
762 tagatttgatgtgttgtttggtataaaagatatacgagggaaataaaagagagagaagtgttgattatttataaaagtactaaga 846  Q
    ||||||| |||  ||||||| ||||| ||| | | ||| |||||| |||||| ||||||||||||||||||||||||||| ||||    
46599 tagattttatggattgtttgttataagagagagatgagagaaatagaagagaaagaagtgttgattatttataaaagtaccaaga 46683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361434 times since January 2019
Visitors: 488