View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L5_1 (Length: 209)

Name: R108-L5_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L5_1
R108-L5_1
[»] chr5 (2 HSPs)
chr5 (61-190)||(28287332-28287461)
chr5 (7-66)||(28287485-28287544)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 61 - 190
Target Start/End: Original strand, 28287332 - 28287461
Alignment:
61 attaatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggagagctagggaaaatttgaaaactcaattctaagacataa 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
28287332 attaatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggagagctaaggaaaatttgaaaactcaattctaagacataa 28287431  T
161 actataagatggatgggtagatttaagcga 190  Q
    ||||||||||||||||||||||||||||||    
28287432 actataagatggatgggtagatttaagcga 28287461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 28287485 - 28287544
Alignment:
7 tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatgattaat 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28287485 tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatgattaat 28287544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204503 times since January 2019
Visitors: 1518