View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L5_1 (Length: 209)
Name: R108-L5_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-L5_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 61 - 190
Target Start/End: Original strand, 28287332 - 28287461
Alignment:
Q |
61 |
attaatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggagagctagggaaaatttgaaaactcaattctaagacataa |
160 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
28287332 |
attaatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggagagctaaggaaaatttgaaaactcaattctaagacataa |
28287431 |
T |
 |
Q |
161 |
actataagatggatgggtagatttaagcga |
190 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
28287432 |
actataagatggatgggtagatttaagcga |
28287461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 28287485 - 28287544
Alignment:
Q |
7 |
tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatgattaat |
66 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28287485 |
tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatgattaat |
28287544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 204503 times since January 2019
Visitors: 1518