View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L5_29 (Length: 233)

Name: R108-L5_29
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L5_29
R108-L5_29
[»] chr5 (2 HSPs)
chr5 (65-124)||(28287335-28287394)
chr5 (8-62)||(28287485-28287539)


Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 65 - 124
Target Start/End: Original strand, 28287335 - 28287394
Alignment:
65 aatttgcctacttacncaatctaacattgattcaatataacgggagaattgagagggaga 124  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
28287335 aatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggaga 28287394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 28287485 - 28287539
Alignment:
8 tatggtattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatga 62  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
28287485 tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatga 28287539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176076 times since January 2019
Visitors: 1578