View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-L5_84 (Length: 201)

Name: R108-L5_84
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-L5_84
R108-L5_84
[»] chr1 (1 HSPs)
chr1 (1-201)||(38666030-38666230)


Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38666230 - 38666030
Alignment:
1 taacataagtgctataccacgtatatcgtcaccaaattgatccttgtgaaatatcaccaacctaatattttggctaaagatcctaactgatcattgtgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
38666230 taacataagtgctataccacgtatatcgtcaccaaattgatccttgtgaaatatcaccaacctaatattttggctaaagatcctaactgatcattgttaa 38666131  T
101 acaaatttacaacttccttataccataagactaattaaagattcaaattaatccttgtgaaaaatcacaaacaacctatttggtctttgagaattaaatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38666130 acaaatttacaacttccttataccataagactaattaaagattcaaattaatccttgtgaaaaatcacaaacaacctatttggtctttgagaattaaatt 38666031  T
201 a 201  Q
    |    
38666030 a 38666030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105964 times since January 2019
Visitors: 1319