View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-16 (Length: 633)

Name: R108-tnk100-16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-16
R108-tnk100-16
[»] chr8 (2 HSPs)
chr8 (96-633)||(42399912-42400449)
chr8 (1-81)||(42400445-42400525)
[»] chr7 (1 HSPs)
chr7 (154-243)||(503625-503714)


Alignment Details
Target: chr8 (Bit Score: 534; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 534; E-Value: 0
Query Start/End: Original strand, 96 - 633
Target Start/End: Original strand, 42399912 - 42400449
Alignment:
96 aattatggaaggacagaatgtcacattacaagcatatcactcctattgctcaaggaagatatagaaacattattgatatgaatgcctaccttggtggatt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
42399912 aattatggaaggacagaatgtcacattacaagcatatcactcctattgctcaaggaagatatagaaacattattgatatgaatgcttaccttggtggatt 42400011  T
196 tgcagcagcattattaaaatttccagtttgggttatgaatgttgttccttcaaattcagctcatgatactcttggtgcaatctttgaaagaggtttcatt 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42400012 tgcagcagcattattaaaatttccagtttgggttatgaatgttgttccttcaaattcagctcatgatactcttggtgcaatctttgaaagaggtttcatt 42400111  T
296 gggacttaccatgattggtgtgaagctttctcaacttaccctagaacttatgatctcatacatgcagctggtgtatttggcatatatcaggataggttgg 395  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42400112 gggacttaccatgattggtgtgaagctttctcaacttaccctagaacttatgatctcatacatgcagctggtgtatttggcatatatcaggataggttgg 42400211  T
396 tatttccatattattatgtgtttttgactgaattaattgttatcatgtgtttttgactgaattaattgttatgtatgaaaggtgcaacattactgttata 495  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42400212 tatttccatattattatgtgtttttgactgaattaattgttatcatgtgtttttgactgaattaattgttatgtatgaaaggtgcaacattactgttata 42400311  T
496 ctattggagatggatagaatcttgaggccagaaggtacagtggtattcagagaaggagtagagcttctcacaaagattaaaagtgttactgatgcaatga 595  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42400312 ctattggagatggatagaatcttgaggccagaaggtacagtggtattcagagaaggagtagagcttctcacaaagattaaaagtgttactgatgcaatga 42400411  T
596 agtggaagagcaacataatggatcatgaaagtggaccc 633  Q
    ||||||||||||||||||||||||||||||||||||||    
42400412 agtggaagagcaacataatggatcatgaaagtggaccc 42400449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 42400445 - 42400525
Alignment:
1 gaccctttttcccagaaaagattcttgttgcggaaaaaacttattggactgggggagctaaagaaaatagcaactaataga 81  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42400445 gaccctttaacccagaaaagattcttgttgcggaaaaaacttattggactgggggagctaaagaaaatagcaactaataga 42400525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 243
Target Start/End: Complemental strand, 503714 - 503625
Alignment:
154 atatagaaacattattgatatgaatgcctaccttggtggatttgcagcagcattattaaaatttccagtttgggttatgaatgttgttcc 243  Q
    |||||||||  |||| |||||||||||   | |||||||||||||||| |||||  | |||| |||||||||||||||||||||||||||    
503714 atatagaaatgttatggatatgaatgctggctttggtggatttgcagctgcattggtgaaatatccagtttgggttatgaatgttgttcc 503625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360199 times since January 2019
Visitors: 482